We're unable to sign you in at this time. Please try again in a few minutes.
We were able to sign you in, but your subscription(s) could not be found. Please try again in a few minutes.
There may be a problem with your account. Please contact the AMA Service Center to resolve this issue.
Contact the AMA Service Center:
Telephone: 1 (800) 262-2350 or 1 (312) 670-7827  *   Email: subscriptions@jamanetwork.com
Error Message ......
Clinical Sciences |

Survey of Patients With Granular, Lattice, Avellino, and Reis-Bücklers Corneal Dystrophies for Mutations in the BIGH3 and Gelsolin Genes FREE

Nasrin A. Afshari, MD; James E. Mullally, MS; Mehran A. Afshari, MD, MPH; Roger F. Steinert, MD; Anthony P. Adamis, MD; Dimitri T. Azar, MD; Jonathan H. Talamo, MD; Claes H. Dohlman, MD, PhD; Thaddeus P. Dryja, MD
[+] Author Affiliations

From the Department of Ophthalmology (Drs N. A. Afshari, M. A. Afshari, Steinert, Adamis, Azar, Talamo, Dohlman, and Dryja), Harvard Medical School and the Ocular Molecular Genetics Institute (Mr Mullally and Dr Dryja), Massachusetts Eye and Ear Infirmary, Boston.

Arch Ophthalmol. 2001;119(1):16-22. doi:10-1001/pubs.Ophthalmol.-ISSN-0003-9950-119-1-ecs00039.
Text Size: A A A
Published online

Objectives  To search for novel mutations that cause corneal stromal dystrophies and to confirm or revise the clinical diagnosis of patients with these mutations.

Patients  Through review of the records of the Cogan Eye Pathology Laboratory at the Massachusetts Eye and Ear Infirmary, Boston, and of clinical records, we ascertained 14 unrelated patients with the clinical or histopathologic diagnosis of granular (3 cases), Avellino (5 cases), lattice (5 cases), or Reis-Bücklers (1 case) corneal dystrophy.

Methods  Clinical records and histopathologic findings of the index patients and their relatives were reviewed. Patients and selected relatives donated a blood sample from which leukocyte DNA was purified and assayed for mutations in the BIGH3 gene and, in 2 patients, the gelsolin gene, using the polymerase chain reaction and direct genomic sequencing.

Results  All index patients with the diagnosis of granular dystrophy or Avellino dystrophy had the missense mutation Arg555Trp or Arg124His, respectively, previously reported in the BIGH3 gene. Of the 5 index patients with a prior diagnosis of lattice dystrophy, 2 had the originally reported lattice mutation (Arg124Cys) in the BIGH3 gene, 1 had a more recently reported missense mutation (His626Arg) in the same gene, 1 had the missense mutation Asp187Asn in the gelsolin gene, and 1 had no detected mutation in either gene. Affected members of the family with Reis-Bücklers dystrophy did not carry the previously reported mutations Arg555Gln or Arg124Leu but instead carried a novel missense mutation Gly623Asp in the BIGH3 gene.

Conclusions  Molecular genetic analysis can improve the accuracy of diagnosis of patients with corneal dystrophies. Two patients with a prior diagnosis of lattice corneal dystrophy had their diagnosis changed to gelsolin-related amyloidosis (1 case) or secondary, nonhereditary localized amyloidosis (1 case). A novel mutation in the BIGH3 gene that causes Reis-Bücklers dystrophy was uncovered through this analysis, and another recently reported novel mutation was encountered. These findings serve to expand our knowledge of the spectrum of pathogenic mutations in BIGH3.

Figures in this Article

THE STUDY by Jones and Zimmerman1 in 1961 provided a framework for the classification of granular, lattice, and macular dystrophies of the corneal stroma according to their clinical appearance and, in particular, their histopathologic staining patterns. Specifically, the dominantly inherited granular and lattice dystrophies featured stromal deposits of hyaline material that was red with the Masson trichrome stain and amyloid material that was highlighted with the Congo red stain, respectively. Corneas with macular dystrophy (recessively inherited) had stromas with an abundance of mucopolysaccharides that stained with Alcian blue.1,2 Subsequent refinement of the diagnostic classification added the categories Avellino dystrophy (a dominantly inherited disease that shares features of both lattice and granular dystrophy),3 lattice type II (a dominantly inherited systemic form of amyloidosis involving the cornea, skin, kidney, and other tissues; also known as Meretoja syndrome),4 lattice type III (a late-onset dystrophy that features amyloid deposits in the stroma and is usually inherited as a recessive trait; it is termed lattice type IIIA when it is inherited as a dominant trait).58

By 1996, genetic linkage studies had shown that the mutations responsible for granular, lattice, and Avellino stromal dystrophies were all within the same region of chromosome 5q, as was the gene for the subepithelial dystrophies called Reis-Bücklers corneal dystrophy or Thiel-Behnke corneal dystrophy.911 The gene that causes macular corneal dystrophy was mapped to chromosome 16q.12 Subsequent studies8,13,14 showed that specific mutations in the BIGH3 gene cause the stromal dystrophies linked to chromosome 5q and cause dominantly inherited lattice corneal dystrophy type IIIA, whose gene had not been previously mapped. Discoveries reported from 1990 to 1992 indicated that lattice type II (Meretoja syndrome) was caused by either of 2 different missense mutations in the gelsolin gene on chromosome band 9q34.1518 The gene responsible for macular corneal dystrophy has recently been identified.19

Herein we report a molecular genetic analysis of the BIGH3 gene in a set of patients with clinically diagnosed corneal dystrophies. The survey was performed to search for novel pathogenic mutations and to test the reliability of the clinicohistopathologic diagnosis of these diseases.

Eleven of the 14 index patients were identified through the archives of the Cogan Eye Pathology Laboratory at the Massachusetts Eye and Ear Infirmary, where specimens obtained during corneal transplantation are processed. Specimens with the diagnosis of lattice, granular, or Avellino dystrophy were reviewed. The corresponding surgeons and subsequently the index patients were contacted and asked to participate in the study by providing a blood sample for DNA analysis. Three index patients ascertained through the clinical practices of the authors had corneal dystrophies not yet treated with a transplant. Affected and unaffected relatives of some patients were contacted and also asked to participate in the study. Table 1 lists the sex, age at the time of the initial penetrating keratoplasty, and the visual acuity in that eye at the time of penetrating keratoplasty. Brief descriptions of the clinical and histologic features of these cases follow.

Table Graphic Jump LocationTable 1. Sex, Age, and Visual Acuity at the Time of the Initial Penetrating Keratoplasty

Three index patients had granular corneal dystrophy. Two patients, GCD1 and GCD2 (pathology numbers E91-4450 and E86-177, respectively), came from families with an inheritance pattern consistent with dominant inheritance. GCD3 has an unknown family history and has not yet undergone penetrating keratoplasty. On slitlamp examination, index case patients had features typical of granular dystrophy (Figure 1A). Histopathologically, the corneas had hyaline deposits in the stroma that stained red with the Masson trichrome stain (Figure 1B).

Place holder to copy figure label and caption
Figure 1.

Slitlamp view (A) and histopathologic appearance (B, Masson trichrome stain) of the cornea of patient GCD1 with granular dystrophy. Slitlamp (C) and histopathologic appearance (D, Masson trichrome stain; E, Congo red stain) of patient ACD2 with Avellino corneal dystrophy. Slitlamp (F) and histopathologic appearance (G, Congo red stain) of the patient LCD2 with lattice corneal dystrophy and the BIGH3 mutation His626Arg. Full-face view (H) of the affected uncle of patient LCD1 with lattice corneal dystrophy type II (Meretoja syndrome demonstrating lax skin). Slitlamp (I) and histopathologic appearance (J, Congo red stain) of index patient LCD1. Slitlamp (K) and histopathologic appearance (L, Congo red stain) of patient LCD5 with no detected mutation in the BIGH3 and gelsolin genes. Slitlamp (M) and histopathologic appearance (N, periodic acid–Schiff stain) of the index patient in the family with Reis-Bücklers corneal dystrophy carrying the novel missense mutation of Gly623Asp. Unaffected cornea (O) of the 34-year-old woman with the BIGH3 mutation Gly623Asp.

Graphic Jump Location

Five patients had Avellino corneal dystrophy. Index patients ACD1 through ACD3 had undergone penetrating keratoplasty (pathology numbers E86-366, S97R44231, and S98A13291, respectively), whereas patients ACD4 and ACD5 had not as yet. All 5 patients with Avellino dystrophy came from families with an apparently dominant inheritance pattern. They all reported ancestors who lived in the area surrounding Avellino, Italy. The index patients had stromal opacities that were larger than those seen in lattice dystrophy and had snowflake shapes(Figure 1C). Histopathologically, the deposits stained with both the Masson trichrome stain and the Congo red stain (Figure 1D-E).


Five index patients had lattice corneal dystrophy. Patients LCD1 through LCD4 (pathology numbers S97D42704, E90-3246, S97F50454, and E84-999, respectively) came from families with corneal dystrophy transmitted in an apparently dominant inheritance pattern. They all had typical latticelike stromal deposits seen with the slitlamp. The clinical and histopathologic findings of one of these patients (LCD2) are shown in Figure 1F-G. Of these 4 index cases, patient LCD1 was notable because the patient's affected maternal uncle had the diagnosis of Ehlers-Danlos syndrome made at another institution because of lax skin (Figure 1H); molecular genetic analysis indicated that the diagnosis of the Ehlers-Danlos syndrome in this family was incorrect (see below). This relative had peripheral neuropathy, but reportedly a peripheral nerve biopsy specimen failed to show amyloid. The patient's sister and mother had similar skin abnormalities by history. Slitlamp and histopathologic findings of the index patient are shown in Figure 1 I-J.

The fifth case of lattice dystrophy, patient LCD5 (pathology number S97T43634), was a 63-year-old woman with no family history of corneal dystrophy. Bilateral corneal opacities were present since the age of 5 years by history. The stromal deposits were diffuse and without lattice lines (Figure 1K). Histopathologically, the corneal stroma had numerous congophilic deposits that showed birefringence and dichroism and were interpreted as consistent with lattice dystrophy (Figure 1L).


One patient had Reis-Bücklers corneal dystrophy. The index patient RBCD1 (pathology number E92-2215) had a history of recurrent painful corneal erosions since childhood. There were subepithelial corneal opacities in a geographic pattern. Histopathologically, Bowman's layer was disrupted with fibrous tissue and hyaline deposits that did not stain with periodic acid–Schiff stain or with the Masson trichrome or Congo red stains. Slitlamp and histopathologic findings are shown in Figure 1M-N.

This study conformed to the Declaration of Helsinki regarding the enrollment of human subjects. Phlebotomy was performed according to standard methods to obtain 10 to 30 mL of venous blood from participating subjects. Leukocyte DNA was purified using proteinase K digestion followed by chloroform and phenol extractions and ethanol precipitation.

The exons of the BIGH3 gene and in 2 patients the gelsolin gene were amplified from leukocyte DNA using the polymerase chain reaction. We evaluated first the exons containing codons 124 and 555, where the originally reported BIGH3 mutations are located. If no mutations were found in these regions, the remainder of the coding sequence was evaluated by direct sequencing. The oligonucleotide primers used for the polymerase chain reaction were those reported by Munier et al,13 with the exception of exons 1, 2, 8, 13, and 17. The primer pairs used to amplify these exons were, respectively (sense/antisense; 5′-3′): GCGCTCTCACTTCCCTGGAG/GACTACCTGACCTTCCGCAG, GGTGGACGTGCTGATCATCT/AGCCAGCGTGCATACAGCTT, CTTGACCTGAGTCTGTTTGG/GAAGTCGCCCAAAGATCTCT, GGGATTAACTCTATCTCCTT/TGTGTATAATTCCATCCTGG, and GGGAGATCTGCACCTATTTG/TGGTGCATTCCTCCTGTAGT. The primer pair used to amplify nucleotides 565 through 680 of the gelsolin gene was reported by de la Chapelle et al.18

Amplified DNA fragments were sequenced directly according to the protocols accompanying the Thermo Sequenase cycle sequencing kit (United States Biochemical, Cleveland, Ohio) and using dideoxynucleotide triphosphates that were α-labeled with phosphorus 33.

All 3 index patients with the clinicohistopathologic diagnosis of granular dystrophy, as well as 2 affected relatives of these patients who participated in this study, had the missense mutation Arg555Trp (CGC to TGG) in the BIGH3 gene. None of the unaffected relatives of these patients was analyzed. All 5 index patients with Avellino dystrophy (ACD1-ACD5) and 3 of their affected relatives had the missense mutation Arg124His (CGC to CAC) in the same gene. None of the unaffected relatives of these patients was analyzed.

Of the 5 index patients with a prior diagnosis of lattice dystrophy, patients LCD3 and LCD4 had the missense mutation Arg124Cys (CGC to TGC) in the BIGH3 gene. One affected relative of one of these patients was analyzed and was found also to carry this mutation, whereas one unaffected relative who was analyzed did not.

Patients LCD1, LCD2, and LCD5 with clinically diagnosed lattice dystrophy had none of the reported mutations affecting codons 555 and 124, so the entire coding sequence of the BIGH3 gene was analyzed. Patient LCD2 (Figure 1F-G) heterozygously carried the missense mutation His626Arg (CAT to CGT). A schematic pedigree of the family of this patient is shown in Figure 2. Of 10 affected relatives who were analyzed (individuals II:15, II:17, III:3, III:6, III:7, III:8, III:10, III:11, IV:1, and IV:2), all carried this same mutation heterozygously. Of 2 unaffected relatives who were analyzed (individuals II:19 and IV:4), 1 carried the mutation and 1 did not. The unaffected carrier (individual IV:4) was 34 years old at the time of the last ocular examination. A slitlamp photograph of the cornea of this patient is shown in Figure 1.

Place holder to copy figure label and caption
Figure 2.

Schematic pedigree of the family with lattice corneal dystrophy and the His626Arg missense mutation (top) and the family with Reis-Bücklers dystrophy and the Gly623Asp mutation (bottom). Arrows point to the index cases. Filled symbols indicate affected individuals. Beneath the symbols of individuals whose DNA was analyzed are their BIGH3 genotypes.

Graphic Jump Location

In patients LCD1 and LCD5, no sequence changes that would alter the primary structure of BIGH3 were found. Subsequently, the sequence of codon 187 of the gelsolin gene was determined in these 2 patients. In patient LCD1, the missense mutation Asp187Asn (GAC to AAC) was found in the gelsolin gene, a mutation previously reported to cause gelsolin-related amyloidosis (Meretoja syndrome).1518 Analysis of DNA from the index patient's affected sister showed that she also carried this mutation heterozygously. We did not analyze the DNA from any other relative in this family. The full-face photograph of the index patient's affected maternal uncle is shown in Figure 1H.

Patient LCD5 had no mutation in the coding sequence of the BIGH3 gene and no mutation of codon 187 in the gelsolin gene. In view of these findings and the negative family history, and because the patient's history and slitlamp findings were atypical for lattice dystrophy, this patient's diagnosis was changed to presumed secondary amyloidosis.

The index patient RBCD1 with Reis-Bücklers corneal dystrophy, a 70-year-old woman, had no defect in the sequence of codons 124 or 555 of the BIGH3 gene. A subsequent determination of the entire BIGH3 coding sequence revealed the missense change Gly623Asp(GGC to GAT) (Figure 3). The patient's affected 89-year-old aunt (I:4) and this aunt's affected 54-year-old son (II:10) also carried the same mutation (see Figure 2 for pedigree). The deceased mother of the index patient was affected by history. DNA from 2 unaffected relatives was also evaluated: a 65-year-old sister (individual II:4) who did not carry this mutation and a 64-year-old maternal cousin (individual II:6) of the index patient who carried this missense mutation. This mutation was not found among a screen of 95 unrelated, healthy control individuals.

Place holder to copy figure label and caption
Figure 3.

DNA sequence around codon 623 of the BIGH3 gene in the index patient RBCD1 (E92-2215) with Reis-Bücklers dystrophy and an unaffected control individual. The patient is heterozygous with both the wild-type sequence of codon 623 (GGC), specifying glycine, and a mutant sequence (GAT), specifying aspartic acid.

Graphic Jump Location

The diagnosis of hereditary corneal dystrophies is customarily based on slitlamp and histopathologic findings. Until the identification of the responsible genes, there was no way to test the accuracy of the clinicopathologic diagnosis. Particularly disconcerting were patients with equivocal or ambiguous findings. Examples were cases with clinical and histopathologic features of both granular and lattice dystrophy (cases now categorized as Avellino dystrophy)3 and cases with features of both granular and Reis-Bücklers dystrophy.20 The identification of the gene defects responsible for most of the corneal dystrophies provides precision to the diagnosis.

Our study demonstrates the diagnostic value of molecular genetic analysis of patients with corneal dystrophies. In 2 cases, DNA analysis altered the prior diagnosis based on clinical and histopathologic findings. In 1 case(LCD1), the patient and some affected relatives had the clinicopathologic diagnosis of lattice dystrophy type I. Lax skin in some affected relatives prompted the additional diagnosis of Ehlers-Danlos syndrome that was presumed to be fortuitously present. Our identification of a mutation in the gelsolin gene provided the correct diagnosis, Meretoja syndrome, which explained both the ocular and systemic disease in the affected family members. In a second case, DNA analysis failed to uncover a mutation in either the BIGH3 or gelsolin gene. Subsequent review of the clinical findings suggested that the corneal amyloid deposits were secondary to a corneal disease of uncertain etiology that occurred in childhood.

The original report13 of mutations in the BIGH3 gene associated each of 4 corneal dystrophies(granular, lattice, Avellino, and Reis-Bücklers) with its own causative mutation. All subsequently described patients with granular or Avellino dystrophy have had the originally reported BIGH3 mutations(Table 2 and Figure 4), suggesting that these clinically defined entities are genetically homogeneous. This is not true for lattice and Reis-Bücklers dystrophies. Although new cases with the originally reported lattice and Reis-Bücklers mutations have been found by other groups, additional mutations in BIGH3 have also been encountered (Table 2). Our analysis adds to the multiplicity of mutations that can cause Reis-Bücklers dystrophy, because our patient carried a novel mutation in the BIGH3 gene. This mutation, Gly623Asp, is 3 codons away from the reported mutation, His626Arg,28,29 causing lattice corneal dystrophy. Gly623Asp is the fourth mutation reported so far to be associated with Reis-Bücklers dystrophy (Table 2).13,30,32 Although one individual who carries the Gly623Asp mutation has not exhibited disease at the age of 64 years, it is nevertheless likely that the mutation is pathogenic, because no other mutation in the coding region of the BIGH3 gene was found in the index patient and because the identified mutation was present in all affected relatives examined. Furthermore, the Gly623Asp change has never been previously reported among patients or healthy controls, and we did not find it in our screening of 95 healthy controls(190 chromosomes). With regard to the unaffected Gly623Asp carrier, it is possible that this patient will develop subepithelial opacities later in life or he may be an example of reduced penetrance of a BIGH3 mutation. To our knowledge, there are no prior examples of reduced penetrance for dominant BIGH3 mutations.

Table Graphic Jump LocationTable 2. Reported Mutations in the BIGH3 Gene Associated With Granular, Lattice, Avellino, and Reis-Bücklers Corneal Dystrophies
Place holder to copy figure label and caption
Figure 4.

Schematic diagram of the primary structure of keratoepithelin, the protein product of the BIGH3 gene (modified from Munier et al13). D1 to D4 represent homologous domains that contain 2 highly conserved repeats designated R and r. Arg-Gly-Asp is a recognition sequence for integrins. Below the diagrams are the locations of the mutations described in this article or previously reported mutations that are associated with granular, Avellino, lattice, and Reis-Bücklers corneal dystrophies.

Graphic Jump Location

We found another possible example of reduced severity vs incomplete penetrance in the family of index patient LCD2 with lattice corneal dystrophy and the mutation His626Arg. A 34-year-old woman in this family (relative IV:4 of patient LCD2) carried this mutation but was asymptomatic and had no corneal deposits seen by slitlamp examination. The affected members of 3 previously reported families with His626Arg mutation exhibited a late disease onset, with symptoms in some cases not arising until the fourth or fifth decade of life.28,29 Considering these reports, one might predict that our 34-year-old asymptomatic carrier will develop lattice dystrophy later in life.

The function of the BIGH3 protein in the cornea is unknown, but its primary sequence (683 amino acids) has features suggesting a role in cell adhesion, perhaps through binding to integrins.33 It is normally produced by the corneal epithelium33,34 and resides in the stroma, particularly in Bowman's layer.35 The protein or degradation products thereof are found in the stromal and subepithelial deposits that characterize granular, lattice, Avellino, and Reis-Bücklers dystrophies.3436 To date, all reported pathogenic mutations in the BIGH3 gene result in the change or deletion of a single amino acid in the encoded protein (Table 2 and Figure 4). We have only a rudimentary knowledge of the protein product of the BIGH3 gene, so it remains unclear how the structures of the mutant protein products form the corneal deposits of various shapes and histopathologic staining patterns.

Although the BIGH3 mutations causing lattice type I, granular, Avellino, and Reis-Bücklers dystrophies are referred to as dominant alleles, at least 2 of them are actually semidominant. Patients who are homozygous for the Avellino (Arg124His)21,22 or granular (Arg555Trp)24 mutations have been identified, and they are more severely affected than heterozygotes, with visually debilitating corneal deposits appearing within the first decade of life and recurring soon after corneal transplantation. It is not known whether the mutations causing lattice type I and Reis-Bücklers dystrophy are semidominant, since homozygotes have not been reported.

Accepted for publication June 23, 2000.

This study was supported by grant EY08683 from the National Eye Institute, Bethesda, Md, and by gifts to the Ocular Molecular Genetics Institute and the Taylor R. Smith Laboratory. Dr Dryja is a Research to Prevent Blindness senior scientific investigator.

Corresponding author and reprints: Thaddeus P. Dryja, MD, Massachusetts Eye and Ear Infirmary, 243 Charles St, Boston, MA 02114 (e-mail: dryja@helix.mgh.harvard.edu).

Jones  STZimmerman  LE Histopathologic differentiation of granular, macular, and lattice dystrophies of the cornea. Am J Ophthalmol. 1961;51394- 410
Jones  STZimmerman  LE Macular dystrophy of the cornea (Groenouw type II). Am J Ophthalmol. 1959;471- 16
Folberg  RAlfonso  ECroxatto  JO  et al.  Clinically atypical granular corneal dystrophy with pathologic features of lattice-like amyloid deposits: a study of three families. Ophthalmology. 1988;9546- 51
Link to Article
Meretoja  J Familial systemic paramyloidosis with lattice dystrophy of the cornea, progressive cranial neuropathy, skin changes and various internal symptoms. Ann Clin Res. 1969;1314- 324
Hida  TTsubota  KKigasawa  KMurata  HOgata  TAkiya  S Clinical features of a newly recognized type of lattice corneal dystrophy. Am J Ophthalmol. 1987;104241- 248
Hida  TProia  ADKigasawa  K  et al.  Histopathologic and immunochemical features of lattice corneal dystrophy type III. Am J Ophthalmol. 1987;104249- 254
Stock  ELFeder  RSO'Grady  RBSugar  JRoth  SI Lattice corneal dystrophy type IIIA: clinical and histopathologic correlations. Arch Ophthalmol. 1991;109354- 358
Link to Article
Yamamoto  SOkada  MTsujikawa  M  et al.  A kerato-epithelin (βig-h3) mutation in lattice corneal dystrophy type IIIA. Am J Hum Genet. 1998;62719- 722
Link to Article
Eiberg  HMoller  HUBerendt  IMohr  J Assignment of granular corneal dystrophy Groenouw type I (CDGG1) to chromosome 5q. Eur J Hum Genet. 1994;2132- 138
Stone  EMMathers  WDRosenwasser  GOD  et al.  Three autosomal dominant corneal dystrophies map to chromosome 5q. Nat Genet. 1994;647- 51
Link to Article
Small  KWMullen  LBarletta  J  et al.  Mapping of Reis-Bücklers' corneal dystrophy to chromosome 5q. Am J Ophthalmol. 1996;121384- 390
Vance  JMJonasson  FLennon  F  et al.  Linkage of a gene for macular corneal dystrophy to chromosome 16. Am J Hum Genet. 1996;58757- 762
Munier  FLKorvatska  EDjemaï  A  et al.  Kerato-epithelin mutations in four 5q31-linked corneal dystrophies. Nat Genet. 1997;15247- 251
Link to Article
Fujiki  KHotta  YNakayasu  K  et al.  A new L527R mutation of the βIGH3 gene in patients with lattice corneal dystrophy with deep stromal opacities. Hum Genet. 1998;103286- 289
Link to Article
Maury  CPJKere  JTolvanen  Rde la Chapelle  A Finnish hereditary amyloidosis is caused by a single nucleotide substitution in the gelsolin gene. FEBS Lett. 1990;27675- 77
Link to Article
Levy  EHaltia  MFernandez-Madrid  I  et al.  Mutation in gelsolin gene in Finnish hereditary amyloidosis. J Exp Med. 1990;1721865- 1867
Link to Article
Gorevic  PDMunoz  PCGorgone  G  et al.  Amyloidosis due to a mutation of the gelsolin gene in an American family with lattice corneal dystrophy type II. N Engl J Med. 1991;3251780- 1785
Link to Article
de la Chapelle  ATolvanen  RBoysen  G  et al.  Gelsolin-derived familial amyloidosis caused by asparagine or tyrosine substitution for aspartic acid at residue 187. Nat Genet. 1992;2157- 160
Link to Article
Akama  TONishida  KNakayama  J  et al.  Macular corneal dystrophy type I and type II are caused by distinct mutations in a new sulphotransferase gene. Nat Genet. 2000;26237- 241
Link to Article
Møller  HU Granular corneal dystrophy Groenouw type I (GrI) and Reis-Bücklers' corneal dystrophy (R-B): one entity? Acta Ophthalmol (Copenh). 1989;67678- 684
Link to Article
Fujiki  KHotta  YNakayasu  KKanai  A Homozygotic patient with βig-h3 gene mutation in granular dystrophy. Cornea. 1998;17288- 292
Link to Article
Okada  MYamamoto  SInoue  Y  et al.  Severe corneal dystrophy phenotype caused by homozygous R124H keratoepithelin mutations. Invest Ophthalmol Vis Sci. 1998;391947- 1953
Korvatska  EMunier  FLDjemaï  A  et al.  Mutation hot spots in 5q31-linked dystrophies. Am J Hum Genet. 1998;62320- 324
Link to Article
Okada  MYamamoto  SWatanabe  H  et al.  Granular corneal dystrophy with homozygous mutations in the kerato-epithelin gene. Am J Ophthalmol. 1998;126169- 176
Link to Article
Gupta  SKHodge  WGDamji  KFGuernsey  DLNeumann  PE Lattice corneal dystrophy type 1 in a Canadian kindred is associated with the Arg124->Cys mutation in the kerato-epithelin gene. Am J Ophthalmol. 1998;125547- 549
Link to Article
Meins  MKohlhaas  MRichard  GGal  A Type I lattice corneal dystrophy: clinical and molecular genetic study of a large family. Klin Monatsbl Augenheilkd. 1998;212154- 158
Link to Article
Endo  SHa  NTFujiki  K  et al.  Leu518Pro mutation of the βig-h3 gene causes lattice corneal dystrophy type I. Am J Ophthalmol. 1999;128104- 106
Link to Article
Stewart  HBalck  GCDonnai  D  et al.  A mutation within exon 14 of the TGFBI causes an asymmetric, late-onset form of lattice corneal dystrophy. Ophthalmology. 1999;106964- 970
Link to Article
Schmitt-Bernard  CGuittard  CArnaud  B  et al.  BIGH3 exon 14 mutations lead to intermediate type I/IIIA of lattice corneal dystrophies. Invest Ophthalmol Vis Sci. 2000;411302- 1308
Okada  MYamamoto  STsujikawa  M  et al.  Two distinct kerato-epithelin mutations in Reis-Bücklers corneal dystrophy. Am J Ophthalmol. 1998;126535- 542
Link to Article
Mashima  YNakamura  YNoda  K  et al.  A novel mutation at codon 124 (R124L) in the BIGH3 gene is associated with a superficial variant of granular corneal dystrophy. Arch Ophthalmol. 1999;11790- 93
Link to Article
Rozzo  CFossarello  MGalleri  G  et al.  A common big-h3 gene mutation (DelF540) in a large cohort of Sardinian Reis Bücklers corneal dystrophy patients. Hum Mutat. 1998;12215- 216
Escribano  JHernando  NGhosh  SCrabb  JCoca-Prados  M cDNA from human ocular ciliary epithelium homologous to βig-h3 is preferentially expressed as an extracellular protein in the corneal epithelium. J Cell Physiol. 1994;160511- 521
Link to Article
Takacs  LBoross  PTozser  JModis  LToth  GBerta  A Transforming growth factor-β–induced protein, βIG-H3, is present in degraded form and altered localization in lattice corneal dystrophy type I. Exp Eye Res. 1998;66739- 745
Link to Article
Streeten  BWQi  YKlintworth  GKEagle  RCStrauss  JABennett  K Immunolocalization of βig-h3 protein in 5q31-linked corneal dystrophies and normal corneas. Arch Ophthalmol. 1999;11767- 75
Link to Article
Klintworth  GKValnickova  ZEnghild  JJ Accumulation of βig-h3 gene product in corneas with granular dystrophy. Am J Pathol. 1998;152743- 748


Place holder to copy figure label and caption
Figure 1.

Slitlamp view (A) and histopathologic appearance (B, Masson trichrome stain) of the cornea of patient GCD1 with granular dystrophy. Slitlamp (C) and histopathologic appearance (D, Masson trichrome stain; E, Congo red stain) of patient ACD2 with Avellino corneal dystrophy. Slitlamp (F) and histopathologic appearance (G, Congo red stain) of the patient LCD2 with lattice corneal dystrophy and the BIGH3 mutation His626Arg. Full-face view (H) of the affected uncle of patient LCD1 with lattice corneal dystrophy type II (Meretoja syndrome demonstrating lax skin). Slitlamp (I) and histopathologic appearance (J, Congo red stain) of index patient LCD1. Slitlamp (K) and histopathologic appearance (L, Congo red stain) of patient LCD5 with no detected mutation in the BIGH3 and gelsolin genes. Slitlamp (M) and histopathologic appearance (N, periodic acid–Schiff stain) of the index patient in the family with Reis-Bücklers corneal dystrophy carrying the novel missense mutation of Gly623Asp. Unaffected cornea (O) of the 34-year-old woman with the BIGH3 mutation Gly623Asp.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 2.

Schematic pedigree of the family with lattice corneal dystrophy and the His626Arg missense mutation (top) and the family with Reis-Bücklers dystrophy and the Gly623Asp mutation (bottom). Arrows point to the index cases. Filled symbols indicate affected individuals. Beneath the symbols of individuals whose DNA was analyzed are their BIGH3 genotypes.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 3.

DNA sequence around codon 623 of the BIGH3 gene in the index patient RBCD1 (E92-2215) with Reis-Bücklers dystrophy and an unaffected control individual. The patient is heterozygous with both the wild-type sequence of codon 623 (GGC), specifying glycine, and a mutant sequence (GAT), specifying aspartic acid.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 4.

Schematic diagram of the primary structure of keratoepithelin, the protein product of the BIGH3 gene (modified from Munier et al13). D1 to D4 represent homologous domains that contain 2 highly conserved repeats designated R and r. Arg-Gly-Asp is a recognition sequence for integrins. Below the diagrams are the locations of the mutations described in this article or previously reported mutations that are associated with granular, Avellino, lattice, and Reis-Bücklers corneal dystrophies.

Graphic Jump Location


Table Graphic Jump LocationTable 1. Sex, Age, and Visual Acuity at the Time of the Initial Penetrating Keratoplasty
Table Graphic Jump LocationTable 2. Reported Mutations in the BIGH3 Gene Associated With Granular, Lattice, Avellino, and Reis-Bücklers Corneal Dystrophies


Jones  STZimmerman  LE Histopathologic differentiation of granular, macular, and lattice dystrophies of the cornea. Am J Ophthalmol. 1961;51394- 410
Jones  STZimmerman  LE Macular dystrophy of the cornea (Groenouw type II). Am J Ophthalmol. 1959;471- 16
Folberg  RAlfonso  ECroxatto  JO  et al.  Clinically atypical granular corneal dystrophy with pathologic features of lattice-like amyloid deposits: a study of three families. Ophthalmology. 1988;9546- 51
Link to Article
Meretoja  J Familial systemic paramyloidosis with lattice dystrophy of the cornea, progressive cranial neuropathy, skin changes and various internal symptoms. Ann Clin Res. 1969;1314- 324
Hida  TTsubota  KKigasawa  KMurata  HOgata  TAkiya  S Clinical features of a newly recognized type of lattice corneal dystrophy. Am J Ophthalmol. 1987;104241- 248
Hida  TProia  ADKigasawa  K  et al.  Histopathologic and immunochemical features of lattice corneal dystrophy type III. Am J Ophthalmol. 1987;104249- 254
Stock  ELFeder  RSO'Grady  RBSugar  JRoth  SI Lattice corneal dystrophy type IIIA: clinical and histopathologic correlations. Arch Ophthalmol. 1991;109354- 358
Link to Article
Yamamoto  SOkada  MTsujikawa  M  et al.  A kerato-epithelin (βig-h3) mutation in lattice corneal dystrophy type IIIA. Am J Hum Genet. 1998;62719- 722
Link to Article
Eiberg  HMoller  HUBerendt  IMohr  J Assignment of granular corneal dystrophy Groenouw type I (CDGG1) to chromosome 5q. Eur J Hum Genet. 1994;2132- 138
Stone  EMMathers  WDRosenwasser  GOD  et al.  Three autosomal dominant corneal dystrophies map to chromosome 5q. Nat Genet. 1994;647- 51
Link to Article
Small  KWMullen  LBarletta  J  et al.  Mapping of Reis-Bücklers' corneal dystrophy to chromosome 5q. Am J Ophthalmol. 1996;121384- 390
Vance  JMJonasson  FLennon  F  et al.  Linkage of a gene for macular corneal dystrophy to chromosome 16. Am J Hum Genet. 1996;58757- 762
Munier  FLKorvatska  EDjemaï  A  et al.  Kerato-epithelin mutations in four 5q31-linked corneal dystrophies. Nat Genet. 1997;15247- 251
Link to Article
Fujiki  KHotta  YNakayasu  K  et al.  A new L527R mutation of the βIGH3 gene in patients with lattice corneal dystrophy with deep stromal opacities. Hum Genet. 1998;103286- 289
Link to Article
Maury  CPJKere  JTolvanen  Rde la Chapelle  A Finnish hereditary amyloidosis is caused by a single nucleotide substitution in the gelsolin gene. FEBS Lett. 1990;27675- 77
Link to Article
Levy  EHaltia  MFernandez-Madrid  I  et al.  Mutation in gelsolin gene in Finnish hereditary amyloidosis. J Exp Med. 1990;1721865- 1867
Link to Article
Gorevic  PDMunoz  PCGorgone  G  et al.  Amyloidosis due to a mutation of the gelsolin gene in an American family with lattice corneal dystrophy type II. N Engl J Med. 1991;3251780- 1785
Link to Article
de la Chapelle  ATolvanen  RBoysen  G  et al.  Gelsolin-derived familial amyloidosis caused by asparagine or tyrosine substitution for aspartic acid at residue 187. Nat Genet. 1992;2157- 160
Link to Article
Akama  TONishida  KNakayama  J  et al.  Macular corneal dystrophy type I and type II are caused by distinct mutations in a new sulphotransferase gene. Nat Genet. 2000;26237- 241
Link to Article
Møller  HU Granular corneal dystrophy Groenouw type I (GrI) and Reis-Bücklers' corneal dystrophy (R-B): one entity? Acta Ophthalmol (Copenh). 1989;67678- 684
Link to Article
Fujiki  KHotta  YNakayasu  KKanai  A Homozygotic patient with βig-h3 gene mutation in granular dystrophy. Cornea. 1998;17288- 292
Link to Article
Okada  MYamamoto  SInoue  Y  et al.  Severe corneal dystrophy phenotype caused by homozygous R124H keratoepithelin mutations. Invest Ophthalmol Vis Sci. 1998;391947- 1953
Korvatska  EMunier  FLDjemaï  A  et al.  Mutation hot spots in 5q31-linked dystrophies. Am J Hum Genet. 1998;62320- 324
Link to Article
Okada  MYamamoto  SWatanabe  H  et al.  Granular corneal dystrophy with homozygous mutations in the kerato-epithelin gene. Am J Ophthalmol. 1998;126169- 176
Link to Article
Gupta  SKHodge  WGDamji  KFGuernsey  DLNeumann  PE Lattice corneal dystrophy type 1 in a Canadian kindred is associated with the Arg124->Cys mutation in the kerato-epithelin gene. Am J Ophthalmol. 1998;125547- 549
Link to Article
Meins  MKohlhaas  MRichard  GGal  A Type I lattice corneal dystrophy: clinical and molecular genetic study of a large family. Klin Monatsbl Augenheilkd. 1998;212154- 158
Link to Article
Endo  SHa  NTFujiki  K  et al.  Leu518Pro mutation of the βig-h3 gene causes lattice corneal dystrophy type I. Am J Ophthalmol. 1999;128104- 106
Link to Article
Stewart  HBalck  GCDonnai  D  et al.  A mutation within exon 14 of the TGFBI causes an asymmetric, late-onset form of lattice corneal dystrophy. Ophthalmology. 1999;106964- 970
Link to Article
Schmitt-Bernard  CGuittard  CArnaud  B  et al.  BIGH3 exon 14 mutations lead to intermediate type I/IIIA of lattice corneal dystrophies. Invest Ophthalmol Vis Sci. 2000;411302- 1308
Okada  MYamamoto  STsujikawa  M  et al.  Two distinct kerato-epithelin mutations in Reis-Bücklers corneal dystrophy. Am J Ophthalmol. 1998;126535- 542
Link to Article
Mashima  YNakamura  YNoda  K  et al.  A novel mutation at codon 124 (R124L) in the BIGH3 gene is associated with a superficial variant of granular corneal dystrophy. Arch Ophthalmol. 1999;11790- 93
Link to Article
Rozzo  CFossarello  MGalleri  G  et al.  A common big-h3 gene mutation (DelF540) in a large cohort of Sardinian Reis Bücklers corneal dystrophy patients. Hum Mutat. 1998;12215- 216
Escribano  JHernando  NGhosh  SCrabb  JCoca-Prados  M cDNA from human ocular ciliary epithelium homologous to βig-h3 is preferentially expressed as an extracellular protein in the corneal epithelium. J Cell Physiol. 1994;160511- 521
Link to Article
Takacs  LBoross  PTozser  JModis  LToth  GBerta  A Transforming growth factor-β–induced protein, βIG-H3, is present in degraded form and altered localization in lattice corneal dystrophy type I. Exp Eye Res. 1998;66739- 745
Link to Article
Streeten  BWQi  YKlintworth  GKEagle  RCStrauss  JABennett  K Immunolocalization of βig-h3 protein in 5q31-linked corneal dystrophies and normal corneas. Arch Ophthalmol. 1999;11767- 75
Link to Article
Klintworth  GKValnickova  ZEnghild  JJ Accumulation of βig-h3 gene product in corneas with granular dystrophy. Am J Pathol. 1998;152743- 748


Meets CME requirements for:
Browse CME for all U.S. States
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
Submit a Comment


Some tools below are only available to our subscribers or users with an online account.

Web of Science® Times Cited: 63

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Collections
PubMed Articles