0
We're unable to sign you in at this time. Please try again in a few minutes.
Retry
We were able to sign you in, but your subscription(s) could not be found. Please try again in a few minutes.
Retry
There may be a problem with your account. Please contact the AMA Service Center to resolve this issue.
Contact the AMA Service Center:
Telephone: 1 (800) 262-2350 or 1 (312) 670-7827  *   Email: subscriptions@jamanetwork.com
Error Message ......
Access to paid content on this site is currently suspended due to excessive activity being detected from your IP address 54.197.87.25. Please contact the publisher to request reinstatement.
Epidemiology |

Cigarette Smoking, CFH, APOE, ELOVL4, and Risk of Neovascular Age-Related Macular Degeneration FREE

Margaret M. DeAngelis, PhD; Fei Ji, PhD; Ivana K. Kim, MD; Scott Adams, BS; Antonio Capone Jr, MD; Jurg Ott, PhD; Joan W. Miller, MD; Thaddeus P. Dryja, MD
[+] Author Affiliations

Author Affiliations: Department of Ophthalmology, Harvard Medical School, and Massachusetts Eye and Ear Infirmary, Boston (Drs DeAngelis, Kim, Miller, and Dryja and Mr Adams); Laboratory of Statistical Genetics, Rockefeller University, New York, NY (Drs Ji and Ott); and Associated Retinal Consultants, PC, William Beaumont Hospital, Royal Oak, Mich (Dr Capone).


Section Editor: Hyman Leslie, PhD

More Author Information
Arch Ophthalmol. 2007;125(1):49-54. doi:10.1001/archopht.125.1.49.
Text Size: A A A
Published online

Objective  To examine if the genes encoding complement factor H (CFH), apolipoprotein E (APOE), and elongation of very-long-chain fatty acids–like 4 (ELOVL4) confer risk of neovascular age-related macular degeneration (AMD) in an independent or interactive manner when controlling for smoking exposure.

Methods  We studied 103 unrelated patients with neovascular AMD who each had at least 1 sibling with normal maculae. Smoking histories were obtained. Genotyping was performed by analyzing amplified genomic fragments from CFH, APOE, and ELOVL4 by direct sequencing or by restriction endonuclease digests. Conditional logistic regression analysis was used to build a multifactor model.

Results  For CFH, only the CC genotype carried a statistically significant elevation of disease risk (odds ratio, 49.37; 95% confidence interval, 6.20-393.22; P<.001). No significant association was observed between neovascular AMD and APOE or ELOVL4. No significant interactions were found between smoking and having the CFH or APOE genotype nor were significant interactions found between the CFH, ELOVL4, and APOE genotypes.

Conclusions  Smoking and having the CFHCC genotype independently increase risk of neovascular AMD. APOE and ELOVL4 genotypes do not seem to modify risk.

Clinical Relevance  Smoking 10 pack-years or more and having the CFHCC genotype increase one's risk of neovascular AMD 144-fold compared with smoking less than 10 pack-years and having the CT or TT genotype.

Figures in this Article

Age-related macular degeneration (AMD) is a common form of legal blindness, with 1.75 million US citizens having advanced AMD in at least 1 eye.1 Approximately 10% of the population aged 43 years and older are affected with some form of the disease, and 30% of the population aged 75 years and older are affected.2 It is estimated that 2.95 million individuals in the United States will have advanced AMD by 2020.1

Previous findings of social, medical, genetic, environmental, and constitutional factors have not been in agreement as to predictors of AMD. Cigarette smoking seems to be the only epidemiological risk factor generally accepted as being associated with an increased risk of AMD,3 while an allelic variant in the complement factor H gene (CFH) seems to be the strongest genetic risk factor. Several independent articles have shown the polymorphism T1277C in CFH to be associated with increased risk of early and late stages of AMD (neovascular and geographic atrophy).411 These findings suggest that the C allele, or disease allele, contributes to almost half of all AMD cases. Some studies1214 have demonstrated that the ε4 allele of the apolipoprotein E gene (APOE) decreases risk of dry or neovascular AMD, but another study15 did not support this finding. In addition, a recent article suggests that the A895G variant of the elongation of the very-long-chain fatty acids–like 4 gene (ELOVL4) may increase risk of neovascular AMD,9 although an earlier study16 did not find this association. Given the multifactorial and heterogeneous nature of AMD, methods that detect weak to moderate associations may be required to identify the contribution that smoking and genetic risk factors such as those associated with CFH, APOE, and ELOVL4 make independently and in combination to risk of AMD. This information may help to more accurately determine the overall risk of neovascular AMD.

Siblings who are discordant for a quantitative trait tend not to share alleles at genetic loci that govern that trait. Sets of siblings who are extremely discordant for a quantitative trait can be a powerful resource for identifying those genes. The prototype of an extreme sibpair consists of one member with a trait value in the top 10% and the other member in the bottom 10% of the population distribution, although pairs in the top 10% and the bottom 30% can be almost as valuable.17,18 Such sibpairs are more likely than pairs of siblings with intermediate trait values to differ at many of the multiple genetic loci that govern a multifactorial trait.

Using such types of sibpairs to search for epidemiological risk factors associated with the neovascular form of AMD, it has been demonstrated that smoking is associated with increased risk of neovascular AMD,19 in support of many previous studies. In the study reported herein, using a phenotypically well-characterized and documented cohort of extremely discordant sibpairs, we examined the roles of CFH, APOE, and ELOVL4 independently and together with smoking history.

The protocol was reviewed and approved by the institutional review board at Massachusetts Eye and Ear Infirmary, Boston, Mass, and the William Beaumont Hospital, Royal Oak, Mich, and conforms to the tenets of the Declaration of Helsinki. Eligible patients were enrolled in this study after they gave informed consent in person, through the mail, or over the telephone, before responding to a standardized questionnaire and donating 10 to 50 mL of venous blood.

PATIENT POPULATION

Index patients with neovascular AMD were recruited from the retina service of the Massachusetts Eye and Ear Infirmary and from Associated Retinal Consultants, PC, William Beaumont Hospital. Details of the recruitment and of the clinical description of the patients are given elsewhere.19 In brief, all index patients had the neovascular form of AMD in at least 1 eye, defined by fibrosis, subretinal hemorrhage, or fluorescein angiographic presence of neovascularization documented at the time of or before enrollment in the study (AMD level 4b on the Age-Related Eye Disease Study scale).20 The unaffected siblings had normal maculae at an age older than that at which the index patient was first diagnosed as having neovascular AMD. Normal maculae (defined as the zone centered at the foveola and extending 2 disc diameters, or 3000 μm, in radius) fulfilled the following criteria: no pigment abnormalities, no geographic atrophy, 0 to 5 small drusen (all <63 μm in diameter), and no neovascularization as defined previously2022 (AMD level 0-1 on the Age-Related Eye Disease Scale). Disease status of every participant was confirmed by at least 2 of the investigators (I.K.K., J.W.M., or T.P.D.) by evaluation of fundus photographs or fluorescein angiograms, except when an investigator directly examined an unaffected sibling during a home visit (6 subjects).

ASCERTAINMENT OF SMOKING EXPOSURE

We administered a standardized questionnaire to all eligible participants in person or over the telephone to ascertain smoking exposure, with the age of the index patient at the time of the fundus photographs as our cutoff reference age for smoking exposure for all members in a sibship. In most cases, the diagnosis of AMD was made simultaneously with the diagnosis of neovascular AMD. If a participant ever smoked, we recorded the age at which he or she started smoking, the age at which the participant quit smoking (if he or she had quit), and the number of packs of cigarettes smoked per day, on average. Based on the responses, the number of pack-years of cigarettes smoked was calculated for each smoker. Participants who had smoked fewer than 100 cigarettes during their lifetime (ie, <1/73 of a pack-year) were categorized as having never smoked. A pack-year was defined as 1 pack of cigarettes per day for 1 year, with 1 pack defined as 20 cigarettes. For our statistical analysis, the reference cutoff for smoking was defined as 10 pack-years or more vs fewer than 10 pack-years. With this cutoff, our subjects were divided into 2 approximately equal groups (Figure).

Place holder to copy figure label and caption
Figure.

Smoking histogram.

Graphic Jump Location
GENETIC ANALYSIS

Leukocyte DNA was purified using standard phenol-chloroform or DNAzol (Invitrogen Corporation, Carlsbad, Calif) extraction protocols. Previously reported oligonucleotide primers based on the flanking intron sequences of exon 9 for CFH, exon 4 for APOE, and exon 6 for ELOVL4 were selected.6,23,24 The primer pairs were as follows (sense primer, antisense primer, both written in the 5"-3" direction): CFH: GGTTTCTTCTTGAAAATCACAGG, CCATTGGTAAAACAAGGTGACA; APOE: TAAGCTTGGCACGGCTGTCCAAGGA, ACAGAATTCGCCCCGGCCTGGTACAC; and ELOVL4: GTTGTTAAAAGTTGTTTACTATTC, TCAACAACAGTTAAGGCCCAGTTC.

For all 3 genes, polymerase chain reaction (PCR) was used to amplify genomic DNA fragments from 20 ng of leukocyte DNA in a solution of 10× PCR buffer containing 25mM magnesium chloride, 0.2mM cytidine 5-triphosphate, 0.2mM deoxyadenosine triphosphate, 0.2mM deoxyguanosine triphosphate, 0.2mM deoxythrombotic thrombocytopenic purpura, and 0.5 U of Taq DNA polymerase (USB Corporation, Cleveland, Ohio). For APOE and ELOVL4, 5 M of betaine (Sigma-Aldrich Inc, St Louis, Mo) was added to each PCR. The temperatures used during PCR were as follows: for APOE, 95°C for 5 minutes, followed by 35 cycles at 66°C for 30 seconds, 72°C for 30 seconds, and 95°C for 30 seconds, with a final annealing at 66°C for 1.5 minutes and extension at 72°C for 5 minutes; and for CFH and ELOVL4, 95°C for 5 minutes, followed by 35 cycles at 56°C for 30 seconds, 72°C for 30 seconds, and 95°C for 30 seconds, with a final annealing at 56°C for 1.5 minutes and extension at 72°C for 5 minutes. For sequencing reactions, PCR products were digested according to the manufacturer's protocol using ExoSAP-IT (USB Corporation) and were then subjected to a cycle sequencing reaction using the Big Dye Terminator version 3.1 cycle sequencing kit (Applied Biosystems, Foster City, Calif) according to the manufacturer's protocol. Products were purified using 96-well plates (Performa DTR Ultra; Edge Biosystems, Gaithersburg, Md) to remove excess dye terminators. Samples were sequenced on a DNA sequencer (ABI Prism 3100; Applied Biosystems). Electropherograms generated from the DNA sequencer were analyzed using Lasergene DNA and protein analysis software (DNASTAR, Inc, Madison, Wis). All patients were sequenced in the forward direction (5′-3′), unless variants, mutations, or polymorphisms were identified, in which case confirmation was obtained in some instances by sequencing in the reverse direction.

STATISTICAL ANALYSIS

Conditional logistic regression (CLR) analysis (SAS version 8.0; SAS Institute Inc, Cary, NC) was performed to identify factors associated with neovascular AMD. Potential risk factors of interest, as already defined, were evaluated initially 1 at a time. A multiple CLR model was built using those factors from the single-factor model that seemed to be associated with neovascular AMD at ≤.12. Nonsignificant variables were then dropped from the multiple CLR model to create the most parsimonious statistical model predictive of neovascular AMD. Using the McNemar test, we performed a separate analysis based on only 1 extremely discordant sibpair per family. We chose the unaffected sibling most discordant in age (the oldest) from the affected member (index patient) in sibships in which there was more than 1 discordant pair. The discordant sibpairs analyzed by the McNemar test were also used to calculate the genotype and allele frequencies for CFH, APOE, and ELOVL4 in affected siblings and, separately, in unaffected siblings. For our 1:1 matched discordant sibpair data, we computed the population attributable risk as θ[(RR−1)/RR], where the relative risk on us is RR is approximated by the odds ratio (OR),25 and θ is the proportion of cases exposed to the factor.

DEMOGRAPHICS OF PARTICIPANTS

We recruited 143 extremely discordant sibpairs derived from 103 sibships. Seven of 103 sibships had more than 1 affected member, and 19 had more than 1 unaffected member. All subjects were 50 years old or older on entrance into the study. As described in the “Methods” section, to ascertain smoking exposure, the mean reference ages of affected and unaffected subjects were calculated based on the date of neovascular AMD diagnosis of the affected sibling. The mean ± SD age of 115 affected siblings was 71.7 ± 7.6 years (age range, 41.3-90.9 years), and the age of 127 unaffected siblings was 72.8 ± 8.8 years (age range, 49.0-86.4 years). Forty percent of the unaffected siblings were male, and 43% of the matching affected siblings were male. All participants were white.

STATISTICAL ANALYSIS

Single-factor CLR analysis demonstrated associations at the <.12 significance level between neovascular AMD and having at least 1 APOE ε4 allele, being homozygous or heterozygous for the CFHC (His) allele, and smoking 10 pack-years or more (Table 1). No significant association was observed between neovascular AMD and having the APOE ε2 or APOE ε3 allele in single-factor analysis. We found no statistically significant association between the ELOVL4G allele for the homozygous (GG) or heterozygous genotype and risk of neovascular AMD. There was no association found with respect to sex (data not shown).

Table Graphic Jump LocationTable 1. Single-Factor Conditional Logistic Regression Analysis of Risk Factors for Neovascular Age-Related Macular Degeneration

Multiple CLR analyses were conducted to determine which risk factors might be independently associated with neovascular AMD. Our multiple CLR model was done in 2 ways (Table 2). For model A, we examined (1) smoking 10 pack-years or more vs fewer than 10 pack-years, (2) having the APOE ε4 allele in the heterozygous (ε2ε4 or ε3ε4) or homozygous (ε4ε4) state vs having no ε4 allele, and (3) having the CFHC (His) allele in the homozygous state (CC) vs having no C allele (TT) or having the C allele in the heterozygous state (CT). Being homozygous for the CFHC allele was significantly associated with neovascular AMD (OR, 49.37; 95% CI, 6.20-393.22; P<.001). Smoking 10 pack-years or more became more significant than in the single-factor analysis (OR, 2.92; 95% CI, 1.41-6.03; P = .004). The presence of at least 1 APOE ε4 allele was not significantly associated with neovascular AMD in the multiple CLR model (OR, 0.71; 95% [confidence interval] CI, 0.29-1.74; P = .45). For model B, we examined (1) having at least 1 APOE ε4 allele, (2) smoking 10 pack-years or more vs fewer than 10 pack-years, and (3) having the CFHC (His) allele separately in the homozygous or heterozygous state vs having no C allele. In this model, having the CFHC (His) allele in the homozygous state was statistically significant (OR, 96.18; 95% CI, 9.98-926.82; P<.001), along with smoking 10 pack-years or more, which (as in model A) became more significant than in the single-factor analysis (OR, 2.95; 95% CI, 1.41-6.15; P = .004). As in model A, the findings in model B suggested that the presence of at least 1 APOE ε4 allele was not significantly associated with risk of neovascular AMD (OR, 0.65; 95% CI, 0.26-1.65; P = .37). Although the ORs for the APOE ε4 allele in model A and model B (0.71 and 0.65, respectively) indicated a trend toward a protective effect with respect to risk of neovascular AMD, this effect was not statistically significant.

Table Graphic Jump LocationTable 2. Multiple Conditional Logistic Regression Analyses of Risk Factors for Neovascular Age-Related Macular Degeneration

After introducing an interaction term into model A, further analysis suggested no interaction between smoking and having the CFHCC genotype, which suggests that these 2 factors affect risk of having neovascular AMD independently. Therefore, the effect of both factors is the product of the risk of the individual factors (ie, a multiplicative effect). For example, homozygotes with the CFHC allele who smoke 10 pack-years or more, compared with individuals with the CFH CT or TT genotype who smoke fewer than 10 pack-years, have a 144-fold risk of neovascular AMD.

Similar to the results from the single-factor analyses, we found using the McNemar test that the CFHCC genotype was much more highly associated with risk of neovascular AMD than the CT genotype. For example, when the CC genotype was compared with the CT or TT genotype (Table 3), there were 26 informative sibpairs (counting only 1 sibpair per family). In 25 of these 26 sibpairs, the affected sibling had the CC genotype (P<.001). In contrast, when individuals with the CC or CT genotype were combined and were compared with those with the TT genotype, there was a much less striking association of neovascular AMD with the CC or CT genotype (P = .03). The McNemar test also showed no significant association between the APOE ε4 allele and neovascular AMD or between ELOVL4 genotypes and neovascular AMD. With regard to ELOVL4, other previously reported variations16 in exon 6 were found, but the number of informative sibpairs was too small for an appropriate statistical analysis. For example, only 1 of 3 sibpairs was discordant for the Ile267Thr variation; the affected member of the sibpair had the sequence change, while the unaffected member did not. The affected member of 1 sibpair exclusively had the Glu272Gln variant, while the unaffected members of 2 other sibpairs exclusively had this sequence change. Both members of 1 sibpair had the Asn284Asp change.

Table Graphic Jump LocationTable 3. Distribution of Sibpairs (1 Extremely Discordant Sibpair per Family)*

The genotype and allele frequencies for CFH, APOE, and ELOVL4 in affected and unaffected siblings are given in Table 4. No significant deviations from Hardy-Weinberg equilibrium for any of the genotypes studied in CFH, APOE, and ELOVL4 were observed in the affected or unaffected sets of siblings. When testing for significant departures from Hardy-Weinberg equilibrium, 1 df was used for the 3 genotypes of CFH and ELOVL4, while 3 df were used for the 6 genotypes of APOE.

Table Graphic Jump LocationTable 4. Distribution of Genotype and Allele Frequencies (1 Extremely Discordant Sibpair per Family)*

The population attributable risk for smoking and having the CFH genotypes is summarized in Table 5. Risk conferred by having the CFHCC genotype is 36%, and risk conferred by having the CFHCC or CT genotype is 49%. Smoking 10 pack-years or more explains 28% of risk in the total population. Because smoking and having the CFHCC or CT genotype are not mutually exclusive, the population attributable risk of smoking 10 pack-years or more and having the CFHCC or CT genotype is 56%.

Table Graphic Jump LocationTable 5. Frequency of Affected Siblings (Index Patients) Exposed to Smoking and CFH Genotype and PAR for Each Factor, While Controlling for the Other Factor

No interaction was found between smoking and having the CFHCC genotype; therefore, the effect of both factors is multiplicative to the risk of neovascular AMD.11 Thirteen of 14 sibships in which both the affected and unaffected siblings had the CFHCC genotype (Table 3) were also concordant for their smoking history, suggesting that other risk factors are yet to be discovered. The single sibship in which both siblings had the CFHCC genotype and were not concordant for their smoking history, the affected sibling had smoked 46 pack-years, while the unaffected sibling had smoked 2 pack-years. Only 1 sibship in our extremely discordant sibpair cohort had an unaffected sibling with the CFHCC genotype and an affected sibling with the CFHCT genotype. This sibpair had discordant smoking histories; the affected sibling had smoked 34 pack-years, while the unaffected sibling had smoked 9 pack-years.

Although having at least 1 CFH C allele (CT or CC) compared with having no CFHC allele (TT) was significantly associated with neovascular AMD in single-factor analysis (Table 1, P = .02), this result was due to the highly significant effect of the CC genotype. Compared with individuals who had no CFHC allele (TT), individuals who were heterozygous for the CFHC allele (CT) had no significant increase in risk of neovascular AMD in multiple CLR analyses (Table 2, model B). These results suggest that CFHCT heterozygotes are not at increased risk of neovascular AMD. This is in contrast to what other groups have reported for neovascular AMD.6,911

The association of CFH alleles with neovascular AMD suggests a role for inflammation and innate immunity in the pathophysiology of the disease. The association with cigarette smoking lends support to a role for oxidative stress and injury. Although our analysis demonstrated that these 2 risk factors are independent of each other, they may work through similar mechanisms to increase risk of neovascular AMD.26

In summary, our analyses of extremely discordant sibpairs provide evidence that having the CFH CC genotype and smoking 10 pack-years or more are independent risk factors for neovascular AMD. APOE and ELOVL4 genotypes do not modify the risk, in agreement with what others have reported.15,16 Smokers of 10 pack-years or more who also have the CFH CC genotype have approximately a 144-fold increase in disease risk compared with individuals who smoke fewer than 10 pack-years and have the CFHCT or TT genotype.

Correspondence: Margaret M. DeAngelis, PhD, Department of Ophthalmology, Harvard Medical School, and Massachusetts Eye and Ear Infirmary, 243 Charles St, Boston, MA 02114 (margaret_deangelis@hms.harvard.edu).

Submitted for Publication: June 30, 2006; final revision received September 25, 2006; accepted September 26, 2006.

Financial Disclosure: None reported.

Funding/Support: This study was supported by grants from the Lincy Foundation, Massachusetts Lions, Ruth and Milton Steinbach Fund, Friends of the Massachusetts Eye and Ear Infirmary, and Genetics of Age-Related Macular Degeneration Fund; Research to Prevent Blindness; as well as by grants EY014458, EY14104, and HG00008 from the National Institutes of Health.

Acknowledgments: We thank the patients and their siblings for their participation in this study. We also thank Amanda J. Harring and Tammy Osentoski for their recruitment efforts. Finally, we thank Anne Marie Lane, MPH, for critical and helpful discussions.

Eye Diseases Prevalence Research Group, Prevalence of age-related macular degeneration in the United States. Arch Ophthalmol 2004;122564- 572
PubMed
Klein  RKlein  BELinton  KL Prevalence of age-related maculopathy: the Beaver Dam Eye Study. Ophthalmology 1992;99933- 943
PubMed
Thornton  JEdwards  RMitchell  P  et al.  Smoking and age-related macular degeneration: a review of association. Eye 2005;19935- 944
PubMed
Edwards  AORitter  R  IIIAbel  KJ  et al.  Complement factor H polymorphism and age-related macular degeneration. Science 2005;308421- 424
PubMed
Klein  RJZeiss  CChew  EY  et al.  Complement factor H polymorphism in age-related macular degeneration. Science 2005;308385- 389
PubMed
Haines  JLHauser  MASchmidt  S  et al.  Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308419- 421
PubMed
Zareparsi  SBranham  KEHLi  M  et al.  Strong association of the Y402H variant in complement factor H at 1q32 with susceptibility to age-related macular degeneration. Am J Hum Genet 2005;77149- 153
PubMed
Hageman  GSAnderson  DHJohnson  LV  et al.  A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc Natl Acad Sci U S A 2005;1027227- 7232
PubMed
Conley  YPThalamuthu  AJakobsdottir  J  et al.  Candidate gene analysis suggests a role for fatty acid biosynthesis and regulation of the complement system in the etiology of age-related maculopathy. Hum Mol Genet 2005;141991- 2002
PubMed
Souied  EHLeveziel  NRichard  F  et al.  Y402H complement factor H polymorphism associated with exudative age-related macular degeneration in the French population. Mol Vis 2005;111135- 1140
PubMed
Sepp  TKhan  JCThurlby  DA  et al.  Complement factor H variant Y402H is a major risk determinant for geographic atrophy and choroidal neovascularization in smokers and nonsmokers. Invest Ophthalmol Vis Sci 2006;47536- 540
PubMed
Klaver  CCKliffen  MVan Duijn  CM  et al.  Genetic association of apolipoprotein E with age-related macular degeneration. Am J Hum Genet 1998;63200- 206
PubMed
Souied  EHBenlian  PAmouyel  P  et al.  The ε4 allele of the apolipoprotein E gene as a potential protective factor for exudative age-related macular degeneration. Am J Ophthalmol 1998;125353- 359
PubMed
Schmidt  SKlaver  CCSaunders  AM  et al.  A pooled case-control study of the apolipoprotein E (APOE) gene in age-related maculopathy. Ophthalmic Genet 2002;23209- 223
PubMed
Schultz  DWKlein  MLHumpert  A  et al.  Lack of an association of apolipoprotein E gene polymorphisms with familial age-related macular degeneration. Arch Ophthalmol 2003;121679- 683
PubMed
Ayyagari  RZhang  KHutchinson  A  et al.  Evaluation of the ELOVL4 gene in patients with age-related macular degeneration. Ophthalmic Genet 2001;22233- 239
PubMed
Risch  NZhang  H Extreme discordant sib pairs for mapping quantitative trait loci in humans. Science 1995;2681584- 1589
PubMed
Risch  NJZhang  H Mapping quantitative trait loci with extreme discordant sib pairs: sampling considerations. Am J Hum Genet 1996;58836- 843
PubMed
DeAngelis  MMLane  AMShah  CP  et al.  Extremely discordant sib-pair study design to determine risk factors for neovascular age-related macular degeneration. Arch Ophthalmol 2004;122575- 580
PubMed
Age-Related Eye Disease Study Research Group, The Age-Related Eye Disease Study system for classifying age-related macular degeneration from stereoscopic color fundus photographs: the Age-Related Eye Disease Study Report Number 6. Am J Ophthalmol 2001;132668- 681
PubMed
Macular Photocoagulation Study Group, Risk factors for choroidal neovascularization in the second eye of patients with juxtafoveal or subfoveal choroidal neovascularization secondary to age-related macular degeneration. Arch Ophthalmol 1997;115741- 747
PubMed
Davis  MDGangnon  RELee  LY  et al.  The Age-Related Eye Disease Study severity scale for age-related macular degeneration: AREDS Report No. 17. Arch Ophthalmol 2005;1231484- 1498
PubMed
Hixson  JEVernier  DT Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res 1990;31545- 548
PubMed
Rivolta  CAyyagari  RSieving  PA  et al.  Evaluation of the ELOVL4 gene in patients with autosomal recessive retinitis pigmentosa and Leber congenital amaurosis. Mol Vis 2003;949- 51
PubMed
Armitage  PBerry  G Statistical Methods in Medical Research. 2nd Malden, Mass Blackwell Scientific Publications1987;
Ottman  R An epidemiologic approach to gene-environment interaction. Genet Epidemiol 1990;7177- 185
PubMed

Figures

Place holder to copy figure label and caption
Figure.

Smoking histogram.

Graphic Jump Location

Tables

Table Graphic Jump LocationTable 1. Single-Factor Conditional Logistic Regression Analysis of Risk Factors for Neovascular Age-Related Macular Degeneration
Table Graphic Jump LocationTable 2. Multiple Conditional Logistic Regression Analyses of Risk Factors for Neovascular Age-Related Macular Degeneration
Table Graphic Jump LocationTable 3. Distribution of Sibpairs (1 Extremely Discordant Sibpair per Family)*
Table Graphic Jump LocationTable 4. Distribution of Genotype and Allele Frequencies (1 Extremely Discordant Sibpair per Family)*
Table Graphic Jump LocationTable 5. Frequency of Affected Siblings (Index Patients) Exposed to Smoking and CFH Genotype and PAR for Each Factor, While Controlling for the Other Factor

References

Eye Diseases Prevalence Research Group, Prevalence of age-related macular degeneration in the United States. Arch Ophthalmol 2004;122564- 572
PubMed
Klein  RKlein  BELinton  KL Prevalence of age-related maculopathy: the Beaver Dam Eye Study. Ophthalmology 1992;99933- 943
PubMed
Thornton  JEdwards  RMitchell  P  et al.  Smoking and age-related macular degeneration: a review of association. Eye 2005;19935- 944
PubMed
Edwards  AORitter  R  IIIAbel  KJ  et al.  Complement factor H polymorphism and age-related macular degeneration. Science 2005;308421- 424
PubMed
Klein  RJZeiss  CChew  EY  et al.  Complement factor H polymorphism in age-related macular degeneration. Science 2005;308385- 389
PubMed
Haines  JLHauser  MASchmidt  S  et al.  Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308419- 421
PubMed
Zareparsi  SBranham  KEHLi  M  et al.  Strong association of the Y402H variant in complement factor H at 1q32 with susceptibility to age-related macular degeneration. Am J Hum Genet 2005;77149- 153
PubMed
Hageman  GSAnderson  DHJohnson  LV  et al.  A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc Natl Acad Sci U S A 2005;1027227- 7232
PubMed
Conley  YPThalamuthu  AJakobsdottir  J  et al.  Candidate gene analysis suggests a role for fatty acid biosynthesis and regulation of the complement system in the etiology of age-related maculopathy. Hum Mol Genet 2005;141991- 2002
PubMed
Souied  EHLeveziel  NRichard  F  et al.  Y402H complement factor H polymorphism associated with exudative age-related macular degeneration in the French population. Mol Vis 2005;111135- 1140
PubMed
Sepp  TKhan  JCThurlby  DA  et al.  Complement factor H variant Y402H is a major risk determinant for geographic atrophy and choroidal neovascularization in smokers and nonsmokers. Invest Ophthalmol Vis Sci 2006;47536- 540
PubMed
Klaver  CCKliffen  MVan Duijn  CM  et al.  Genetic association of apolipoprotein E with age-related macular degeneration. Am J Hum Genet 1998;63200- 206
PubMed
Souied  EHBenlian  PAmouyel  P  et al.  The ε4 allele of the apolipoprotein E gene as a potential protective factor for exudative age-related macular degeneration. Am J Ophthalmol 1998;125353- 359
PubMed
Schmidt  SKlaver  CCSaunders  AM  et al.  A pooled case-control study of the apolipoprotein E (APOE) gene in age-related maculopathy. Ophthalmic Genet 2002;23209- 223
PubMed
Schultz  DWKlein  MLHumpert  A  et al.  Lack of an association of apolipoprotein E gene polymorphisms with familial age-related macular degeneration. Arch Ophthalmol 2003;121679- 683
PubMed
Ayyagari  RZhang  KHutchinson  A  et al.  Evaluation of the ELOVL4 gene in patients with age-related macular degeneration. Ophthalmic Genet 2001;22233- 239
PubMed
Risch  NZhang  H Extreme discordant sib pairs for mapping quantitative trait loci in humans. Science 1995;2681584- 1589
PubMed
Risch  NJZhang  H Mapping quantitative trait loci with extreme discordant sib pairs: sampling considerations. Am J Hum Genet 1996;58836- 843
PubMed
DeAngelis  MMLane  AMShah  CP  et al.  Extremely discordant sib-pair study design to determine risk factors for neovascular age-related macular degeneration. Arch Ophthalmol 2004;122575- 580
PubMed
Age-Related Eye Disease Study Research Group, The Age-Related Eye Disease Study system for classifying age-related macular degeneration from stereoscopic color fundus photographs: the Age-Related Eye Disease Study Report Number 6. Am J Ophthalmol 2001;132668- 681
PubMed
Macular Photocoagulation Study Group, Risk factors for choroidal neovascularization in the second eye of patients with juxtafoveal or subfoveal choroidal neovascularization secondary to age-related macular degeneration. Arch Ophthalmol 1997;115741- 747
PubMed
Davis  MDGangnon  RELee  LY  et al.  The Age-Related Eye Disease Study severity scale for age-related macular degeneration: AREDS Report No. 17. Arch Ophthalmol 2005;1231484- 1498
PubMed
Hixson  JEVernier  DT Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res 1990;31545- 548
PubMed
Rivolta  CAyyagari  RSieving  PA  et al.  Evaluation of the ELOVL4 gene in patients with autosomal recessive retinitis pigmentosa and Leber congenital amaurosis. Mol Vis 2003;949- 51
PubMed
Armitage  PBerry  G Statistical Methods in Medical Research. 2nd Malden, Mass Blackwell Scientific Publications1987;
Ottman  R An epidemiologic approach to gene-environment interaction. Genet Epidemiol 1990;7177- 185
PubMed

Correspondence

CME
Meets CME requirements for:
Browse CME for all U.S. States
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
NOTE:
Citing articles are presented as examples only. In non-demo SCM6 implementation, integration with CrossRef’s "Cited By" API will populate this tab (http://www.crossref.org/citedby.html).
Submit a Comment

Multimedia

Some tools below are only available to our subscribers or users with an online account.

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Topics
PubMed Articles
JAMAevidence.com