We're unable to sign you in at this time. Please try again in a few minutes.
We were able to sign you in, but your subscription(s) could not be found. Please try again in a few minutes.
There may be a problem with your account. Please contact the AMA Service Center to resolve this issue.
Contact the AMA Service Center:
Telephone: 1 (800) 262-2350 or 1 (312) 670-7827  *   Email: subscriptions@jamanetwork.com
Error Message ......
Epidemiology |

Apolipoprotein E Gene and Age-Related Maculopathy in Older Individuals:  The Cardiovascular Health Study FREE

Gabriella Tikellis, PhD; Cong Sun, MD, MPH; Michael B. Gorin, MD, PhD; Ronald Klein, MD, MPH; Barbara E. K. Klein, MD, MPH; Emily K. Marino Larsen, MS; David S. Siscovick, MD, MPH; Larry D. Hubbard, MAT; Tien Y. Wong, MD, PhD
[+] Author Affiliations

Author Affiliations: Centre for Eye Research Australia, University of Melbourne, Victoria (Drs Tikellis, Sun, and Wong); Department of Ophthalmology, University of Pittsburgh, Pittsburgh, Pa (Dr Gorin and Mr Hubbard); Department of Ophthalmology, University of Wisconsin, Madison (Drs R. Klein and B. E. K. Klein); Departments of Biostatistics (Ms Larsen) and Medicine and Epidemiology (Dr Siscovick), University of Washington, Seattle; Singapore Eye Research Institute, National University of Singapore, Singapore (Dr Wong).

Section Editor: Hyman Leslie, PhD

More Author Information
Arch Ophthalmol. 2007;125(1):68-73. doi:10.1001/archopht.125.1.68.
Text Size: A A A
Published online

Objective  To examine the association between the apolipoprotein E (APOE) gene and age-related maculopathy (ARM) in an older population.

Methods  Two thousand one hundred seventy persons 65 years and older sampled from 4 US communities had ARM signs assessed from retinal photographs using a modified Wisconsin Age-Related Maculopathy Grading System. DNA extracted from blood samples was analyzed for common APOE alleles.

Results  After controlling for age, sex, cigarette smoking, and other factors, white participants carrying the ε2 allele had an increased risk of late ARM (odds ratio, 2.53 [95% confidence interval, 1.08-5.90]) while carriers of the ε4 allele had a lower risk of late ARM (odds ratio, 0.69 [95% confidence interval, 0.19-2.50]). There were too few late ARM cases in African American individuals for analysis.

Conclusion  APOE polymorphism is associated with late ARM in older white persons 65 years and older. Consistent with previous studies, the APOE ε2 allele is associated with a significant increased risk of late ARM development, whereas the ε4 allele may confer some protection.

Age-related maculopathy (ARM) is a leading cause of visual impairment in the elderly population.1 Genetic predisposition to ARM has been hypothesized,2 and specific genes (eg, complement factor H) have recently been identified.35

The apolipoprotein E (APOE) gene, a major apolipoprotein of the central nervous system and a key regulator of lipid transport,6 has been linked with a variety of neurodegenerative and cardiovascular disorders, including Alzheimer disease7 and stroke,8 and is another attractive candidate gene to investigate possible links with ARM. However, previous studies that have examined the association of the APOE gene and ARM have shown somewhat inconsistent results.918 Of the 3 common alleles of APOE (ε2, ε3, and ε4), the ε4 carrier has been inversely associated with late ARM in some,913,16 but not all,14,15 studies, whereas the ε2 carrier may be associated with an increased ARM risk.9,12,16,17

The majority of these studies have been clinic based, and few population-based data are available.9 Further, there have been suggestions that the relationship between APOE and ARM is modified by age and possibly race.3,11,14,15,17 In particular, 1 study showed a significant protective association of the ε4 carrier and ARM only among participants younger than 70 years and not in older persons.17 It was suggested that genetic factors may play a less important role in the pathogenesis of ARM in older people.

The Cardiovascular Health Study (CHS) is a population-based study of white and African American persons 65 years and older at baseline.19 We have previously reported the prevalence of ARM in the CHS.20 In the current study, we examine its association with APOE.


The CHS has been previously described.19 The original cohort recruited 5201 persons in 1989-1990 in 4 field centers: Forsyth County, North Carolina; Washington County, Maryland; Sacramento County, California; and Pittsburgh, Pa. An additional 687 eligible African American individuals were recruited from Forsyth County, Sacramento County, and Pittsburgh in 1992-1993.21 This report used data from the 1997-1998 examination, when retinal photography was first performed.20 Of the 4249 participants (95.6% of survivors) who were contacted for this examination, we excluded 29 participants whose race was neither white nor African American, 491 without APOE data, and 1559 who were not examined in the clinic and did not have retinal photography or who had ungradeable photographs, leaving 2170 who provided data for the current analysis. Differences between persons with and without gradable retinal photographs have been previously reported.20 In general, persons who did not have retinal photography or had ungradeable photographs were older and, while controlling for age, were more likely to be African American and female; to have diabetes mellitus and hypertension; and to be current cigarette smokers. There were no significant age-adjusted differences between those included and excluded with regard to body mass index, hypertension status, systolic blood pressure, plasma total cholesterol level, high-density lipoprotein (HDL) cholesterol level, low-density lipoprotein cholesterol level, and common carotid intima media thickness.20


The retinal photography procedure and retinal grading have been previously reported.20,22 Briefly, a 45° nonmydriatic retinal photograph of 1 randomly selected eye of each participant was taken at the follow-up examination following 5 minutes of dark adaptation. The photograph was centered on the region of the optic disc and the macula. The photographs were sent to the University of Wisconsin Fundus Reading Center, Madison, for assessment and grading of ARM. Trained graders masked to the subject identity evaluated the photographs using a modification of the Wisconsin Age-Related Maculopathy Grading System.23

For grading, a grid consisting of 2 circles concentric with the center of the macula and 4 radial lines was superimposed over the photograph. The presence of soft drusen, retinal pigment epithelial depigmentation, increased retinal pigment, pure geographic atrophy, and signs of exudative macular degeneration (subretinal hemorrhage, subretinal fibrous scar, retinal pigment epithelial detachment, and/or serous detachment of the sensory retina) were determined in the macular area circumscribed by the outermost circle of the grading grid. The circle had a radius that corresponded to 3450 μm in the fundus of an average eye.

Soft drusen were defined as those having a diameter larger than 63 μm. Retinal pigment epithelial depigmentation, increased retinal pigment associated with ARM (the presence of granules or clumps of gray or black pigment in or beneath the retina), and pigmentary abnormalities were defined as present or absent/questionable. Early ARM was defined as the presence of either soft drusen alone, retinal pigment epithelial de pigmentation alone, or a combination of soft drusen with increased retinal pigment and/or depigmentation in the absence of late ARM.20,23 Late ARM was defined as the presence of signs of exudative ARM degeneration or pure geographic atrophy.20,23


Genotyping of APOE in the CHS has been previously described.24,25 Only participants who gave consent for DNA use for noncardiovascular outcomes were included in this analysis. We analyzed separately the 3 common carriers of APOE (ε2, ε3, and ε4) and its 6 common genotypes. The 3 major allelic forms of the APOE gene were determined in the Core Molecular Genetics facility at the University of Vermont College of Medicine by the method of Hixson and Vernier.26 The 2 primers used for polymerase chain reaction amplification, done in 96-well microtiter plates, were 5′GGCACGGCTGTCCAAGGA3′ and 5′ACAGAATTCGCCCCGGCCTGGTACAC3′. Amplitaq T4 DNA polymerase was obtained from Perkin-Elmer (Wellesley, Mass); the restriction enzyme HhaI was obtained from New England BioLabs (Ipswich, Mass). DNA samples known to be ε4/ε2 and ε2/ε3 were analyzed with each batch as positive controls. The restriction patterns were determined with the use of agarose electrophoresis.26


Participants underwent clinical and laboratory assessment of cardiovascular diseases and its risk factors during the course of the study.2729 Relevant portions are highlighted herein. Blood pressures were taken according to a standardized protocol.27 Hypertension was defined as systolic blood pressure of 140 mm Hg or higher, diastolic blood pressure of 90 mm Hg or higher, or the combination of self-reported high blood pressure diagnosis and use of antihypertensive medications. Medical history, medication use, cigarette smoking, and alcohol consumption status were ascertained from questionnaires. Technicians assessed body mass index (calculated as weight in kilograms divided by height in meters squared) and the waist-hip ratio. Blood collection, processing, and definitions for fasting glucose level; total, low-density lipoprotein, and HDL cholesterol levels; and triglyceride level are described elsewhere.19 All variables defined were based on the 1997-1998 clinic examination, concurrent with retinal photography, except data on most blood chemistry results and body measurements, which were taken from the 1992-1993 examination.


We examined whether the distribution of APOE carriers (any ε2, ε3, and ε4) and specific genotypes by presence or absence of ARM was in Hardy-Weinberg equilibrium using the χ2 test. Where the reliability of P values based on χ2 approximations was questionable, we report P values for Fisher exact test. We calculated odds ratios (ORs) and 95% confidence intervals (CIs) for ARM by APOE genotype frequency using the ancestral ε3/ε3 as the reference group in logistic regression models. In the multivariate analysis, we adjusted for age, sex, race, cigarette smoking, hypertension, and glucose and total triglyceride levels for models of early ARM and age, sex, race, cigarette smoking, hypertension, and HDL cholesterol level for late ARM. Because genotype frequency differed by race, analyses were also performed separately in white individuals and African American individuals.

Finally, APOE variation was also modeled in a risk score model, because risk scores have been demonstrated to increase power in modeling genetic exposures.30 Because previous studies suggested ε4 conferred protection while ε2 increased risk, a genotypic risk scoring system was devised to test this hypothesis, which respectively assigned +1, 0, or −1 risk units for each ε2, ε3, or ε4 carrier of an individual with genotypes (scores) of ε2/ε2 (+2), ε2/ε3 (+1), ε2/ε4 (+0), ε3/ε3 (+0), ε3/ε4 (−1), and ε4/ε4 (−2). All P values are 2-sided and STATA 8.2 (StataCorp, College Station, Tex) was used for all analyses.

Characteristics between persons with early ARM (n = 336) or late ARM (n = 28) compared with those with no ARM (n = 1806) are presented in Table 1. In general, persons with early ARM were significantly older, less likely to be African American, and had a higher plasma glucose level than persons without ARM, while persons with late ARM were significantly older and had a significantly higher plasma HDL cholesterol level compared with those with no ARM. All other characteristics were not associated with any ARM status.

Table Graphic Jump LocationTable 1. Participant Characteristics by Presence of Early and Late ARM*

Table 2 shows the prevalence of no ARM, early and late ARM, and specific early ARM signs by APOE allele carrier and genotype status. The APOE carrier and genotype distribution did not differ significantly between subjects with early ARM or early ARM signs compared with those with no ARM.

Table Graphic Jump LocationTable 2. Distribution of APOE Allele and Genotype by Specific ARM Signs

The prevalence of early and late ARM as compared with no ARM by APOE allele carrier and genotype status in white and African American individuals is presented in Table 3. Overall, ε3/ε3 was the dominant genotype and ε3, the dominant allele carrier in both white and African American individuals. White individuals with late ARM were more likely to have the ε2 allele (18.5%) and less likely to have the ε4 allele (7.4%) as compared with white individuals with no ARM (8.7% and 12.6%; P<.05 for both comparisons). African American individuals with early ARM were more likely to carry the ε2 allele (24.1%) as compared with those with no ARM (13.4%; P<.05).

Table Graphic Jump LocationTable 3. Distribution of APOE Allele and Genotype by Early and Late ARM in White and African American Individuals

Table 4 shows multivariate logistic regression models of early and late ARM, controlling for age, sex, race, cigarette smoking, and other factors. In all persons, white individuals, and African American individuals, neither ε2 carriers nor ε4 carriers were associated with early ARM. In all persons and white individuals, ε2 carriers were more likely to have late ARM (OR, 2.53 for both groups) after multivariable adjustment, while the ε4 carrier was associated with a slightly decreased but not significant risk of late ARM in all persons (OR, 0.89 [95% CI, 0.28-2.79]) and in white individuals (OR, 0.69 [95% CI, 0.19-2.50]).

Table Graphic Jump LocationTable 4. Association of APOE Carrier and Genotype With Early or Late ARM in All Persons, White Individuals, and African American Individuals*

The results of the logistic regression models for early and late ARM by APOE risk score are shown in Table 4. There was a significant association between increasing APOE score and late ARM in white individuals (OR, 1.87 [95% CI, 1.01-3.47]) after controlling for other factors, but no associations were found for early ARM.

Finally, Table 4 shows that in comparison with the ε3/ε3 genotype, the ε2/ε3 genotype was associated with an increased risk of having late ARM in all persons (OR, 2.74 [95% CI, 1.14-6.58]) and in white individuals (OR, 2.78 [95% CI, 1.16-6.67])

Mounting evidence from molecular investigations,10,31 animal models,32 and epidemiologic studies913,16,17 indicates that APOE is associated with ARM development. Previous studies that have examined a possible relationship between APOE and ARM have suggested a lower risk of ARM913,16 in carriers of the ε4 allele while, less consistently, the ε2 carrier appears to confer an increased risk of ARM.9,12,16,17 Our results concur with these findings in that the frequency of carrying the ε4 allele was significantly lower and the frequency of carrying the ε2 allele was significantly higher in white individuals with late ARM as compared with white individuals with no ARM. After adjusting for age, sex, cigarette smoking, total triglyceride level, and hypertension, we observed a 2.5-fold increased risk in all persons and white individuals with late ARM if they were carriers of the ε2 allele and a nonsignificant 31% decrease in risk for white individuals of having late ARM if they were ε4 carriers.

Because 1 study reported a significant protective association of the ε4 carrier and ARM only among participants younger than 70 years,17 it has been suggested that genetic factors may play a more important role in the etiology of ARM in younger people. Our current study, however, shows that APOE polymorphism may still have a significant role in late ARM development in older persons (mean age of 78 years in the current study).

With regard to early ARM, we did not find a consistent pattern of association with APOE. In particular, we found no evidence that the ε4 carrier was associated with a lower risk or that the ε2 carrier was associated with a higher risk of early ARM. It is possible that the lack of a consistent association of APOE and early ARM in our study reflects the more prominent role of APOE on the development of late ARM signs only. This was also observed by Baird and colleagues,12 in which significant associations of APOE ε2 and ε4 with ARM were confined to late disease.

One of the purposes of this study was to investigate possible racial variation in the association of APOE and ARM. In contrast to white populations, the association between APOE and ARM has been inconsistent in studies of other ethnic groups such as Chinese14 and Italian16 populations. In our study, there was a significant difference in the distribution of the APOE genotype in African American individuals with early ARM as compared with those with no ARM. In fact, African American subjects with the ε2/ε4 genotype had an almost 7-fold higher risk of early ARM compared with those who had the ε3/ε3 genotype (multivariate adjusted OR, 6.42 [95% CI, 1.47-28.12], data not shown). This association was not seen in white individuals, where ARM was more prevalent.

In a recent report by Schmidt et al,33 the possible association between exudative ARM and APOE ε2 carriers was suggested to be stronger in cigarette smokers compared with people who had never smoked, although the finding was not significant. In our cohort, we also examined the association of APOE and early ARM in persons who were current or previous cigarette smokers compared with those who were never smokers. The multivariate adjusted odds of having early ARM among participants who were ε2 carriers was increased but not significantly so among participants who had a history of smoking (OR, 1.40 [95% CI, 0.89-2.20]). In contrast, participants who were ε2 carriers and had never smoked were at a reduced risk of having early ARM (OR, 0.80 [95% CI, 0.50-1.27]). Larger epidemiologic studies are required to provide further evidence to support these findings.

The current study has a number of strengths. These include a population drawn from the community, a large sample size, standardized ARM evaluation from photographs, and detailed information on a variety of potential risk factors. Several important limitations should also be mentioned. First, the CHS used a 45° nonstereoscopic fundus photograph taken through nonpharmacologically dilated pupils to determine the presence of ARM. Thus, the sensitivity related to the detection of ARM (in particular, early ARM signs) is more likely to be lower compared with the prevalence of ARM assessed from photographs taken with pharmacologically dilated pupils. Similarly, the grading of ARM is more variable when assessed through nonpharmacologically dilated pupils compared with the grading of 30° stereoscopic fundus photographs taken through dilated pupils.34 In addition, because the CHS was primarily interested in examining the value of retinal vascular signs in the prediction of cardiovascular disease, only 1 randomly selected eye was photographed. This may lead to an increased variability of ARM detection, which in turn increases the likelihood of measurement error and misclassification. However, misclassification of the small number of “false-negative” cases (ie, true ARM cases misclassified as noncases) is unlikely to substantially bias the results except toward the null.

Second, selection bias may have obscured associations because the study population was derived from the cohort examined 10 years from the baseline. If persons with ARM and the ε2 or ε4 carrier were less likely to participate in this examination because of higher mortality, Alzheimer disease, or other reasons, the potential ARM-APOE association could be falsely distorted.

Finally, as noted earlier, we did not have sufficient cases of late ARM in African American individuals to analyze potential associations with APOE. In fact, the CHS population had a lower prevalence of late ARM cases in both racial groups analyzed (1.3%) compared with other population-based studies, such as the Beaver Dam Eye Study (1.6%)35 and the Blue Mountains Eye Study (1.9%).36 The lower prevalence may be attributed to the use of a nonmydriatic camera, which resulted in less ARM being detected, or the fact that retinal photographs were only taken at the 10-year follow-up examination when many of the participants who may have had late ARM (and thus were more likely to be older) were either unable to attend the examination because of poor health or may have died in the interim or, alternatively, the CHS population may have a lower prevalence of late ARM cases.

In conclusion, in this older, population-based cohort, we showed that the ε2 carrier may be associated with an increased risk of developing late ARM. While the ε4 carrier appears to confer some protection, the association was not statistically significant. These findings were largely confined to white persons.

Correspondence: Tien Y. Wong, MD, PhD, Retinal Vascular Imaging Centre, Centre for Eye Research Australia, University of Melbourne, 32 Gisborne St, East Melbourne 3002, Australia (twong@unimelb.edu.au).

Submitted for Publication: October 27, 2005; final revision received February 15, 2006; accepted February 22, 2006.

Financial Disclosure: None reported.

Funding/Support: This work was supported by Cardiovascular Health Study contract NHLBI HC-97-06 from the National Heart, Lung and Blood Institute (NHLBI), National Institutes of Health (NIH), Bethesda, Md. Additional support was provided by grant R21-HL077166 from NHLBI, NIH and the Sylvia and Charles Viertel Clinical Investigator Award (Dr Wong).

Tielsch  JMSommer  AWitt  KKatz  JRoyall  RM Blindness and visual impairment in an American urban population: the Baltimore Eye Survey. Arch Ophthalmol 1990;108286- 290
PubMed Link to Article
Gorin  MBBreitner  JCDe Jong  PT  et al.  The genetics of age-related macular degeneration. Mol Vis 1999;529
Haines  JLHauser  MASchmidt  S  et al.  Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308419- 421
PubMed Link to Article
Klein  RJZeiss  CChew  EY  et al.  Complement factor H polymorphism in age-related macular degeneration. Science 2005;308385- 389
PubMed Link to Article
Edwards  AORitter  R  IIIAbel  KJManning  APanhuysen  CFarrer  LA Complement factor H polymorphism and age-related macular degeneration. Science 2005;308421- 424
PubMed Link to Article
Mahley  RW Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science 1988;240622- 630
PubMed Link to Article
Evans  DABeckett  LAField  TS  et al.  Apolipoprotein E epsilon4 and incidence of Alzheimer disease in a community population of older persons. JAMA 1997;277822- 824
PubMed Link to Article
Slooter  AJTang  MXvan Duijn  CM  et al.  Apolipoprotein E epsilon4 and the risk of dementia with stroke: a population-based investigation. JAMA 1997;277818- 821
PubMed Link to Article
Klaver  CCKliffen  Mvan Duijn  CM  et al.  Genetic association of apolipoprotein E with age-related macular degeneration. Am J Hum Genet 1998;63200- 206
PubMed Link to Article
Souied  EHBenlian  PAmouyel  P  et al.  The epsilon4 allele of the apolipoprotein E gene as a potential protective factor for exudative age-related macular degeneration. Am J Ophthalmol 1998;125353- 359
PubMed Link to Article
Schmidt  SKlaver  CSaunders  A  et al.  A pooled case-control study of the apolipoprotein E (APOE) gene in age-related maculopathy. Ophthalmic Genet 2002;23209- 223
PubMed Link to Article
Baird  PNGuida  EChu  DTVu  HTGuymer  RH The epsilon2 and epsilon4 alleles of the apolipoprotein gene are associated with age-related macular degeneration. Invest Ophthalmol Vis Sci 2004;451311- 1315
PubMed Link to Article
Zareparsi  SReddick  ACBranham  KE  et al.  Association of apolipoprotein E alleles with susceptibility to age-related macular degeneration in a large cohort from a single center. Invest Ophthalmol Vis Sci 2004;451306- 1310
PubMed Link to Article
Pang  CPBaum  LChan  WMLau  TCPoon  PMLam  DS The apolipoprotein E epsilon4 allele is unlikely to be a major risk factor of age-related macular degeneration in Chinese. Ophthalmologica 2000;214289- 291
PubMed Link to Article
Schultz  DWKlein  MLHumpert  A  et al.  Lack of an association of apolipoprotein E gene polymorphisms with familial age-related macular degeneration. Arch Ophthalmol 2003;121679- 683
PubMed Link to Article
Simonelli  FMargaglione  MTesta  F  et al.  Apolipoprotein E polymorphisms in age-related macular degeneration in an Italian population. Ophthalmic Res 2001;33325- 328
PubMed Link to Article
Schmidt  SSaunders  AMDe La Paz  MA  et al.  Association of the apolipoprotein E gene with age-related macular degeneration: possible effect modification by family history, age, and gender. Mol Vis 2000;6287- 293
Wong  TYShankar  AKlein  R  et al.  Apolipoprotein E gene and early age-related maculopathy: the Atherosclerosis Risk in Communities Study. Ophthalmology 2006;113255- 259
PubMed Link to Article
Fried  LPBorhani  NOEnright  P  et al.  The Cardiovascular Health Study: design and rationale. Ann Epidemiol 1991;1263- 276
PubMed Link to Article
Klein  RKlein  BEMarino  EK  et al.  Early age-related maculopathy in the cardiovascular health study. Ophthalmology 2003;11025- 33
PubMed Link to Article
Tell  GSFried  LPHermanson  B  et al.  Recruitment of adults 65 years and older as participants in the Cardiovascular Health Study. Ann Epidemiol 1993;3358- 366
PubMed Link to Article
Wong  TYHubbard  LDKlein  R  et al.  Retinal microvascular abnormalities and blood pressure in older people: the Cardiovascular Health Study. Br J Ophthalmol 2002;861007- 1013
PubMed Link to Article
Klein  RDavis  MDMagli  YLSegal  PKlein  BEHubbard  L The Wisconsin age-related maculopathy grading system. Ophthalmology 1991;981128- 1134
PubMed Link to Article
Kuller  LHShemanski  LManolio  T  et al.  Relationship between ApoE, MRI findings, and cognitive function in the Cardiovascular Health Study. Stroke 1998;29388- 398
PubMed Link to Article
Haan  MNShemanski  LJagust  WJManolio  TAKuller  L The role of APOE epsilon4 in modulating effects of other risk factors for cognitive decline in elderly persons. JAMA 1999;28240- 46
PubMed Link to Article
Hixson  JEVernier  D Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res 1990;31545- 548
Tell  GSRutan  GHKronmal  RA  et al.  Correlates of blood pressure in community-dwelling older adults: the Cardiovascular Health Study. Cardiovascular Health Study (CHS) Collaborative Research Group. Hypertension 1994;2359- 67
PubMed Link to Article
Robbins  JWahl  PSavage  P  et al.  Hematological and biochemical laboratory values in older Cardiovascular Health Study participants. J Am Geriatr Soc 1995;43855- 859
Cushman  MCornell  ESHoward  PR  et al.  Laboratory methods and quality assurance in the Cardiovascular Health Study. Clin Chem 1995;41264- 270
Kaslow  RACarrington  MApple  R  et al.  Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nat Med 1996;2405- 411
PubMed Link to Article
Anderson  DHOzaki  SNealon  M  et al.  Local cellular sources of apolipoprotein E in the human retina and retinal pigmented epithelium: implications for the process of drusen formation. Am J Ophthalmol 2001;131767- 781
PubMed Link to Article
Elizabeth Rakoczy  PYu  MJNusinowitz  SChang  BHeckenlibely  JR Mouse models of age-related macular degeneration. Exp Eye Res 2006;82741- 752
PubMed Link to Article
Schmidt  SHaines  JLPostel  EA  et al.  Joint effects of smoking history and APOE genotypes in age-related macular degeneration. Mol Vis 2005;11941- 949
Klein  RMeuer  SMMoss  SEKlein  BEK Detection of drusen and early signs of age-related maculopathy using a nonmydriatic camera and a standard fundus camera. Ophthalmology 1992;991686- 1692
PubMed Link to Article
Klein  RKlein  BEKLinton  KL Prevalence of age-related maculopathy: the Beaver Dam Eye Study. Ophthalmology 1992;99933- 943
PubMed Link to Article
Mitchell  PSmith  WAttebo  KWang  JJ Prevalence of age-related maculopathy in Australia: the Blue Mountains Eye Study. Ophthalmology 1995;1021450- 1460
PubMed Link to Article



Table Graphic Jump LocationTable 1. Participant Characteristics by Presence of Early and Late ARM*
Table Graphic Jump LocationTable 2. Distribution of APOE Allele and Genotype by Specific ARM Signs
Table Graphic Jump LocationTable 3. Distribution of APOE Allele and Genotype by Early and Late ARM in White and African American Individuals
Table Graphic Jump LocationTable 4. Association of APOE Carrier and Genotype With Early or Late ARM in All Persons, White Individuals, and African American Individuals*


Tielsch  JMSommer  AWitt  KKatz  JRoyall  RM Blindness and visual impairment in an American urban population: the Baltimore Eye Survey. Arch Ophthalmol 1990;108286- 290
PubMed Link to Article
Gorin  MBBreitner  JCDe Jong  PT  et al.  The genetics of age-related macular degeneration. Mol Vis 1999;529
Haines  JLHauser  MASchmidt  S  et al.  Complement factor H variant increases the risk of age-related macular degeneration. Science 2005;308419- 421
PubMed Link to Article
Klein  RJZeiss  CChew  EY  et al.  Complement factor H polymorphism in age-related macular degeneration. Science 2005;308385- 389
PubMed Link to Article
Edwards  AORitter  R  IIIAbel  KJManning  APanhuysen  CFarrer  LA Complement factor H polymorphism and age-related macular degeneration. Science 2005;308421- 424
PubMed Link to Article
Mahley  RW Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science 1988;240622- 630
PubMed Link to Article
Evans  DABeckett  LAField  TS  et al.  Apolipoprotein E epsilon4 and incidence of Alzheimer disease in a community population of older persons. JAMA 1997;277822- 824
PubMed Link to Article
Slooter  AJTang  MXvan Duijn  CM  et al.  Apolipoprotein E epsilon4 and the risk of dementia with stroke: a population-based investigation. JAMA 1997;277818- 821
PubMed Link to Article
Klaver  CCKliffen  Mvan Duijn  CM  et al.  Genetic association of apolipoprotein E with age-related macular degeneration. Am J Hum Genet 1998;63200- 206
PubMed Link to Article
Souied  EHBenlian  PAmouyel  P  et al.  The epsilon4 allele of the apolipoprotein E gene as a potential protective factor for exudative age-related macular degeneration. Am J Ophthalmol 1998;125353- 359
PubMed Link to Article
Schmidt  SKlaver  CSaunders  A  et al.  A pooled case-control study of the apolipoprotein E (APOE) gene in age-related maculopathy. Ophthalmic Genet 2002;23209- 223
PubMed Link to Article
Baird  PNGuida  EChu  DTVu  HTGuymer  RH The epsilon2 and epsilon4 alleles of the apolipoprotein gene are associated with age-related macular degeneration. Invest Ophthalmol Vis Sci 2004;451311- 1315
PubMed Link to Article
Zareparsi  SReddick  ACBranham  KE  et al.  Association of apolipoprotein E alleles with susceptibility to age-related macular degeneration in a large cohort from a single center. Invest Ophthalmol Vis Sci 2004;451306- 1310
PubMed Link to Article
Pang  CPBaum  LChan  WMLau  TCPoon  PMLam  DS The apolipoprotein E epsilon4 allele is unlikely to be a major risk factor of age-related macular degeneration in Chinese. Ophthalmologica 2000;214289- 291
PubMed Link to Article
Schultz  DWKlein  MLHumpert  A  et al.  Lack of an association of apolipoprotein E gene polymorphisms with familial age-related macular degeneration. Arch Ophthalmol 2003;121679- 683
PubMed Link to Article
Simonelli  FMargaglione  MTesta  F  et al.  Apolipoprotein E polymorphisms in age-related macular degeneration in an Italian population. Ophthalmic Res 2001;33325- 328
PubMed Link to Article
Schmidt  SSaunders  AMDe La Paz  MA  et al.  Association of the apolipoprotein E gene with age-related macular degeneration: possible effect modification by family history, age, and gender. Mol Vis 2000;6287- 293
Wong  TYShankar  AKlein  R  et al.  Apolipoprotein E gene and early age-related maculopathy: the Atherosclerosis Risk in Communities Study. Ophthalmology 2006;113255- 259
PubMed Link to Article
Fried  LPBorhani  NOEnright  P  et al.  The Cardiovascular Health Study: design and rationale. Ann Epidemiol 1991;1263- 276
PubMed Link to Article
Klein  RKlein  BEMarino  EK  et al.  Early age-related maculopathy in the cardiovascular health study. Ophthalmology 2003;11025- 33
PubMed Link to Article
Tell  GSFried  LPHermanson  B  et al.  Recruitment of adults 65 years and older as participants in the Cardiovascular Health Study. Ann Epidemiol 1993;3358- 366
PubMed Link to Article
Wong  TYHubbard  LDKlein  R  et al.  Retinal microvascular abnormalities and blood pressure in older people: the Cardiovascular Health Study. Br J Ophthalmol 2002;861007- 1013
PubMed Link to Article
Klein  RDavis  MDMagli  YLSegal  PKlein  BEHubbard  L The Wisconsin age-related maculopathy grading system. Ophthalmology 1991;981128- 1134
PubMed Link to Article
Kuller  LHShemanski  LManolio  T  et al.  Relationship between ApoE, MRI findings, and cognitive function in the Cardiovascular Health Study. Stroke 1998;29388- 398
PubMed Link to Article
Haan  MNShemanski  LJagust  WJManolio  TAKuller  L The role of APOE epsilon4 in modulating effects of other risk factors for cognitive decline in elderly persons. JAMA 1999;28240- 46
PubMed Link to Article
Hixson  JEVernier  D Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI. J Lipid Res 1990;31545- 548
Tell  GSRutan  GHKronmal  RA  et al.  Correlates of blood pressure in community-dwelling older adults: the Cardiovascular Health Study. Cardiovascular Health Study (CHS) Collaborative Research Group. Hypertension 1994;2359- 67
PubMed Link to Article
Robbins  JWahl  PSavage  P  et al.  Hematological and biochemical laboratory values in older Cardiovascular Health Study participants. J Am Geriatr Soc 1995;43855- 859
Cushman  MCornell  ESHoward  PR  et al.  Laboratory methods and quality assurance in the Cardiovascular Health Study. Clin Chem 1995;41264- 270
Kaslow  RACarrington  MApple  R  et al.  Influence of combinations of human major histocompatibility complex genes on the course of HIV-1 infection. Nat Med 1996;2405- 411
PubMed Link to Article
Anderson  DHOzaki  SNealon  M  et al.  Local cellular sources of apolipoprotein E in the human retina and retinal pigmented epithelium: implications for the process of drusen formation. Am J Ophthalmol 2001;131767- 781
PubMed Link to Article
Elizabeth Rakoczy  PYu  MJNusinowitz  SChang  BHeckenlibely  JR Mouse models of age-related macular degeneration. Exp Eye Res 2006;82741- 752
PubMed Link to Article
Schmidt  SHaines  JLPostel  EA  et al.  Joint effects of smoking history and APOE genotypes in age-related macular degeneration. Mol Vis 2005;11941- 949
Klein  RMeuer  SMMoss  SEKlein  BEK Detection of drusen and early signs of age-related maculopathy using a nonmydriatic camera and a standard fundus camera. Ophthalmology 1992;991686- 1692
PubMed Link to Article
Klein  RKlein  BEKLinton  KL Prevalence of age-related maculopathy: the Beaver Dam Eye Study. Ophthalmology 1992;99933- 943
PubMed Link to Article
Mitchell  PSmith  WAttebo  KWang  JJ Prevalence of age-related maculopathy in Australia: the Blue Mountains Eye Study. Ophthalmology 1995;1021450- 1460
PubMed Link to Article


Meets CME requirements for:
Browse CME for all U.S. States
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
Submit a Comment


Some tools below are only available to our subscribers or users with an online account.

Web of Science® Times Cited: 15

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Collections
PubMed Articles

Users' Guides to the Medical Literature
Clinical Resolution

Users' Guides to the Medical Literature
Clinical Scenario