0
We're unable to sign you in at this time. Please try again in a few minutes.
Retry
We were able to sign you in, but your subscription(s) could not be found. Please try again in a few minutes.
Retry
There may be a problem with your account. Please contact the AMA Service Center to resolve this issue.
Contact the AMA Service Center:
Telephone: 1 (800) 262-2350 or 1 (312) 670-7827  *   Email: subscriptions@jamanetwork.com
Error Message ......
Laboratory Sciences |

Increased Angiogenic Factors Associated With Peripheral Avascular Retina and Intravitreous Neovascularization:  A Model of Retinopathy of Prematurity FREE

Steven J. Budd, MS; M. Elizabeth Hartnett, MD
[+] Author Affiliations

Author Affiliations: Department of Ophthalmology, School of Medicine, University of North Carolina, Chapel Hill.


Arch Ophthalmol. 2010;128(5):589-595. doi:10.1001/archophthalmol.2010.65.
Text Size: A A A
Published online

Objectives  To determine expression of vascular endothelial growth factor (VEGF), pigment epithelium–derived factor, and their respective receptors in retinas using a model of retinopathy of prematurity.

Methods  Retinas isolated from a 50/10 oxygen (inspired oxygen cycled between 50% oxygen and 10% oxygen every 24 hours)–induced rat model of retinopathy of prematurity (50/10 OIR model), and from room air–raised rat pups (RA) at birth, age 14 days (persistent peripheral avascular retina in the 50/10 OIR model and complete retinal vascularization in RA) and age 18 days (intravitreous neovascularization in the 50/10 OIR model) were analyzed for messenger RNA of VEGF164, neuropilin 1, neuropilin 2, VEGF receptor 1, VEGF receptor 2, pigment epithelium–derived factor, and pigment epithelium–derived factor receptor by real-time polymerase chain reaction.

Results  In the 50/10 OIR model compared with RA, fold changes in expression of VEGF164, neuropilin 1, and neuropilin 2 were significantly increased at ages 14 and 18 days. A trend for increased fold change was noted in expression of VEGF receptor 2 at age 14 days and a significant increase at age 18 days in the 50/10 OIR model compared with RA. Pigment epithelium–derived factor receptor was significantly increased at age 14 days in the 50/10 OIR model compared with RA.

Conclusion  Increased expression of VEGF164 and angiogenic receptors were found in association with both avascular retina at day 14 and intravitreous neovascularization at day 18 in a relevant model of retinopathy of prematurity.

Clinical Relevance  Increased VEGF and angiogenic receptors may have a role in the development of peripheral avascular retina and stage 3 retinopathy of prematurity.

Figures in this Article

Interactions between neural and vascular growth factors and receptors are important in ordered retinal vascularization.1 For example, the vascular endothelial growth factor (VEGF) family and signaling pathway are important in retinal vascular development2,3 and in neuronal survival.4,5 The neuropilins (NPs), originally described as receptors for proteins involved in neuronal axon guidance, can form complexes with VEGF receptors (VEGFRs) and act as coreceptors for VEGF-mediated angiogenic signaling.1 Pigment epithelium–derived factor (PEDF) is a neurotrophic factor6 and is involved in retinal vascular development.7 One way in which PEDF may be involved in normal vascularization is by downregulating VEGF expression and interfering with its binding to VEGFR2,8 believed to be the receptor most involved in angiogenic processes.9 However, both VEGF and PEDF interactions have been found in pathologic angiogenesis.

Because the VEGF signaling pathway and PEDF are important in physiologic and pathologic angiogenesis,2,3,7,8 we aimed to determine expression of these factors and their respective receptors in a model that is relevant to clinical retinopathy of prematurity (ROP). Previous investigations of the effects of oxygen stresses on expression of VEGF isoforms found that VEGF164 was the most prevalent isoform and was increased by successive fluctuations in oxygen level,10 a risk factor for modern-day ROP.11,12 In this study, we used the same 50/10 oxygen–induced rat model of ROP (50/10 OIR model) developed by Penn et al,13 which exposes rat pups to successive fluctuations in oxygen level. The model reproducibly and consistently develops peripheral avascular retina, similar to zone 2 ROP, followed by intravitreous neovascularization at the junction of vascular and avascular retina, similar to zone 2, stage 3 ROP. Previous investigations of ROP have used oxygen-induced retinopathy models that expose animals to extreme constant hyperoxia to create vasoretraction of the central retinal capillaries. The most well known of these is the mouse model developed by Smith et al.14 During the obliterative phase, VEGF messenger RNA (mRNA) expression was downregulated in conjunction with arrest and loss of developing retinal vasculature.15 The newly formed capillaries can be protected from death by administering growth factors1618 or nutrients19,20 before hyperoxia. On return to room air, relative retinal hypoxia triggers signaling of VEGF and other angiogenic factors with capillary budding into the vitreous,21 and this proliferative phase can be prevented by administering agents to inhibit angiogenic factors such as VEGF.22

We used a relevant model of zone 2, stage 3 ROP (50/10 OIR model) to measure mRNA of VEGF164, PEDF, and their respective receptors. We hypothesized (1) that angiogenic factors would be downregulated in the 50/10 OIR model at age 14 days (persistent peripheral avascular retina) compared with room air–raised rat pups (RA) at age 14 days (complete retinal vascularization) and (2) that angiogenic factors would be upregulated in the 50/10 OIR model at age 18 days (intravitreous neovascularization) compared with RA.

All animal studies complied with the University of North Carolina's Institute for Laboratory Animal Research (Guide for the Care and Use of Laboratory Animals). They were also in accord with the Association for Research in Vision in Ophthalmology's Statement for the Use of Animals in Ophthalmic and Visual Research.

50/10 OIR MODEL

We used a model of zone 2, stage 3 severe ROP (50/10 OIR).13 The model induces rat arterial oxygen levels13 that replicate extremes in transcutaneous oxygen levels of human preterm infants who develop severe ROP.12 Within 4 hours of birth, at postnatal age 0 days (p0), litters of 12 to 14 Sprague-Dawley rat pups with their mothers (Charles River, Wilmington, Massachusetts) were placed in an incubator (Oxycycler; Biospherix, New York, New York) to cycle inspired oxygen between 50% oxygen and 10% oxygen every 24 hours until p14. After 7 cycles of oxygen fluctuations, rat pups were placed in room air for 4 days. Oxygen levels were monitored daily and recalibrated as needed. Carbon dioxide in the cage was also monitored daily and flushed from the system by maintaining sufficient gas flow and by adding soda lime. The 50/10 OIR model develops vascular tortuosity at p12, peripheral avascular retina at p14 (Figure 1) (when development of retinal vascularization is completed in RA), and intravitreous neovascularization at p18 (Figure 2).23

Place holder to copy figure label and caption
Figure 1.

Lectin-stained retinal flat mount from a rat pup at postnatal age 14 days in the 50/10 oxygen–induced rat model of retinopathy of prematurity following 7 cycles of oxygen fluctuations every 24 hours between 50% oxygen and 10% oxygen. Peripheral avascular retina persists, whereas room air–raised rat pup counterparts have fully vascularized retina.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 2.

Lectin-stained retinal flat mount from a rat pup at postnatal age 18 days in the 50/10 oxygen–induced rat model of retinopathy of prematurity (7 cycles of oxygen fluctuations every 24 hours between 50% oxygen and 10% oxygen, followed by 4 days in room air). Intravitreous neovascularization exists at the junction of vascular and avascular retina.

Graphic Jump Location

Compared with RA at the same time points after birth, it was previously shown that rat pups raised in an environment of oxygen cycling had increased areas of peripheral avascular retina.10 At p14, after 7 cycles of fluctuations in oxygen level, the percentage of avascular to total retinal area was 33% in the 50/10 OIR model, whereas RA had fully vascularized retinas in which the inner capillary plexus covered the retina to the ora serrata.

DISSECTION OF RETINAL TISSUE FOR mRNA ANALYSES

Rat pups were euthanized using pentobarbital sodium (intraperitoneal injection of 80 mg/kg of body weight), and retinas were isolated using a modification of the technique by Chan-Ling.24 Retinas were dissected, without ora serratas, from at least 5 separate rat pups for each time point in RA or the 50/10 OIR model. Separate litters were used for each time point and condition to assure adequate litter size and consistency of features in the 50/10 OIR model. Replicate experiments were performed for each condition and time point. Tissue was frozen (RNAlater; Applied Biosystems, Foster City, California) until analysis.

REAL-TIME POLYMERASE CHAIN REACTION

Retinas were homogenized in lysis buffer, and total RNA was extracted (RNeasy; Qiagen, Studio City, California). A kit (DNA-free, Applied Biosystems) was used to remove DNA contamination, and RNA quantity was determined. One microgram of RNA was reverse transcribed using a kit (High-Capacity cDNA Reverse Transcription, Applied Biosystems). The VEGF164 was chosen because it is the most prevalent of VEGF isoforms associated with intravitreous neovascularization in the 50/10 OIR model, is upregulated by repeated oxygen fluctuations,10 and is a ligand for NP1, which acts as a coreceptor with VEGFR2.1 Primers for the following were made by the University of North Carolina's Oligonucleotide Synthesis Core Facility (http://www.med.unc.edu/olioli/index.htm): VEGF164 (5′GCACATAGGAGAGATGAGCT 3′, 5′GCTCACAGTGATTTT CTGGC3′, Fam TGCAG CATAGCAGATGTGAATGCAGACC Tamara), VEGFR1 (5′CCACCTCCATGTTTGAAGAC3′, 5′AGTCCAGGTGAATCGCTTCA3′, Fam TACCAGCAGTCTGCTGACCTCCCC Tamara), VEGFR2 (5′CTCCATCTTTTGGTGGGATG3′, 5′GCTGGTCTGGTTGGAGCCT3′, Fam AGGCCACAGACTCCCTGCTTTTACTG3 Tamara), PEDF (5′CCAACTCTTTGCAGGACATG3′, 5′TCACAGGTTTGCCGGTAATC3′, Fam ACAGTCCTTGTTTGAGTCCCCTGAC Tamara), NP1 (5′GGAGCTACTGGGCTGTGAAG3′, 5′ATGTGGGGAAGTCTGA3′, Fam CACCCAATGGGAACCTA Tamara), NP2 (5′ACACAAGGAGCCATTTCCAG3′, 5′CGGATCCTGATGAAACGAGT3′, Fam CAAAGGGGGAAGATTGGATG Tamara), and PEDF receptor (PEDFR) (5′CCAACTCTTTGCAGGACATC3′, 5′TCACAGGTTTGCCGGTAATC3′, Fam ACAGTCCTTGTTTGAGTCCCCTGAC Tamara).25 Complementary DNA was mixed 1:1 with a master mix (Taqman Universal Master Mix, Applied Biosystems) and primers. Triplicate samples were cycled in a polymerase chain reaction (PCR) system (AB 7500, Applied Biosystems). The system's software calculates cycle threshold automatically for each well. Rat β-actin, which we found was stably expressed in retinas under these oxygen stresses, was used as the control gene and was amplified with forward and reverse primers TGCCTGACGGTCAGGTCA and CAGGAAGGAAGGCTGGAAG, respectively. Duplicate reactions with a total volume of 16 μL were run for each sample and control using the PCR system, and again the cycle threshold was automatically calculated for each well. Cycle threshold values were normalized to β-actin and were expressed as fold increase over the p0 value for each growth factor or receptor, enabling comparisons between RA and 50/10 OIR.

STATISTICAL ANALYSIS

For real-time PCR analysis, samples from RA and the 50/10 OIR model were normalized to β-actin for each ligand or receptor group to allow comparisons of fold differences in expression within each group. t Test was used to analyze fold changes in mRNA expression of each ligand or receptor in RA vs the 50/10 OIR model at p14 and p18.

EXPRESSION OF GROWTH FACTORS AND THEIR RECEPTORS IN RA

In RA, the retinal extent is fully covered by retinal vessels at p14. The VEGF164 mRNA expression increased 3-fold between p0 and p14 (Figure 3). The fold changes in expression differed between p0 and p14 for each of 4 angiogenic receptors and coreceptors involved in VEGF signaling (VEGFR1, VEGFR2, NP1, and NP2). Whereas VEGFR2 increased 5-fold (Figure 4), VEGFR1 increased approximately 42-fold (Figure 5). There was little change in expression of NP1 (Figure 6), and NP2 increased approximately 5-fold (Figure 7). The PEDF and PEDFR expression increased about 5- and 4-fold, respectively, between p0 and p14 (Figure 8 and Figure 9).

Place holder to copy figure label and caption
Figure 3.

Fold change in isoform vascular endothelial growth factor 164 (VEGF164) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in VEGF164 mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P < .001) and at 18 days (**P = .02) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 4.

Fold change in vascular endothelial growth factor receptor 2 (VEGFR2) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in VEGFR2 mRNA expression was present in 50/10 OIR compared with RA at 18 days (*P = .004). A trend toward increased fold change in VEGFR2 mRNA expression was noted in the 50/10 OIR model at 14 days (P = .06) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 5.

Fold change in vascular endothelial growth factor receptor (VEGFR1) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). No significant differences were found at 14 days (P = .47) or at 18 days (P = .97) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 6.

Fold change in neuropilin 1 (NP1) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in NP1 mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P = .04) and at 18 days (**P = .03) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 7.

Fold change in neuropilin 2 (NP2) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in NP2 mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P = .001) and at 18 days (**P = .002) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 8.

Fold change in pigment epithelium–derived factor (PEDF) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). No significant difference was found at 14 days (P = .47) or at 18 days (P = .39) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 9.

Fold change in pigment epithelium–derived factor receptor (PEDFR) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in PEDFR mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P < .001). No significant difference was found at 18 days (P = .32) (t test).

Graphic Jump Location
EXPRESSION OF GROWTH FACTORS AND THEIR RECEPTORS AT p14 DURING PERSISTENT PERIPHERAL AVASCULAR RETINA IN THE 50/10 OIR MODEL

The 50/10 OIR model exposes animals to repeated fluctuations in hyperoxia and hypoxia and causes delayed retinal vascularization,26 believed to contribute to peripheral avascular retina at p14, when RA have fully vascularized retinas. Because VEGF is important in developmental angiogenesis2,3 and because the 50/10 OIR model has incomplete retinal vascularization compared with RA,10 we anticipated that mRNA of VEGF164, VEGFRs, and coreceptors would have lower expression at p14 in the 50/10 OIR model compared with RA. However, we found that VEGF164 expression increased, with an almost 10-fold change between p0 and p14 in the 50/10 OIR model, and this represented a 3-fold increase in expression compared with RA (Figure 3). This finding also contrasts with results using the mouse oxygen-induced retinopathy model, in which VEGF expression was lower than that in room air during hyperoxia-induced vaso-obliteration.15

Compared with p0, all receptors had increased expression at p14 in the 50/10 OIR model, and all except VEGFR1 had increased fold change in expression compared with RA (Figures 4, 5, 6, and 7). The fold change in expression of NP1 and NP2 was significantly increased in the 50/10 OIR model compared with RA, whereas there was a trend for increased fold change in expression of VEGFR2 in the 50/10 OIR model. The fold changes in PEDF and PEDFR mRNA expression increased between p0 and p14, and there was a significantly increased fold change in PEDFR mRNA expression in the 50/10 OIR model compared with RA (Figure 9). There was little fold difference in PEDF mRNA expression in RA vs the 50/10 OIR model at p14 (Figure 8).

EXPRESSION OF GROWTH FACTORS AND THEIR RECEPTORS AT p18 DURING INTRAVITREOUS NEOVASCULARIZATION IN THE 50/10 OIR MODEL

The 50/10 OIR model rat pups are moved to a hyperoxic environment (from 10% oxygen to 21% oxygen [ie, room air]) at p14. At p18, intravitreous neovascularization develops at the junction of vascular and avascular retina. In association with intravitreous neovascularization at p18, we found greater fold changes in expression of VEGF164, VEGFR2, NP1, and NP2 compared with RA (Figures 3, 4, 6, and 7). The fold change in expression of VEGFR1 was similar to that in RA (Figure 5).

Because PEDF is an angiogenic inhibitor, we anticipated that PEDF and PEDFR would be reduced at p18 compared with RA. However, the fold changes in expression of PEDF and PEDFR at p18 were not significantly greater than those in RA (Figures 8 and 9).

In the 50/10 OIR model compared with RA, we found increased fold changes in mRNA of VEGF164, VEGFR2, and the NPs at p18 in association with intravitreous neovascularization. This was anticipated because VEGF164, VEGFR2, and the NPs are involved in angiogenic processes. However, at p14 in association with persistent peripheral avascular retina in the 50/10 OIR model, the fold change in mRNA expression of VEGF164 and both NPs (and a trend for increased VEGFR2) was greater than in RA, in which retinal vascularization was complete at p14. Furthermore, the fold change in VEGFR1 mRNA expression, believed to limit the amount of VEGF ligand present to signal through VEGFR2 during development, was not significantly elevated in the 50/10 OIR model vs RA. These were unexpected findings based on data from the mouse model of oxygen-induced retinopathy, in which VEGF was downregulated during “vaso-obliteration”15 and was upregulated during angiogenesis.22

The VEGF and PEDF are involved in pathologic angiogenesis and physiologic developmental retinal angiogenesis and are regulated by oxygen tension.2,3,7,27,28 Expression of VEGF is upregulated by hypoxia27 and expression of PEDF by hyperoxia.28 Pigment epithelium–derived factor is a potent angiogenic inhibitor,28 whereas VEGF is an agonist.27 Vascular endothelial growth factor receptor 2 is believed to be important in angiogenesis, whereas VEGFR1 is thought to bind and limit the amount of VEGF ligand that can signal through VEGFR2,9 permitting ordered developmental angiogenesis. It is increasingly recognized that the NPs are also important in angiogenic processes.1 Neuropilin 1 was initially described as a receptor for the semaphorins and as an axonal guide in the central nervous system. Akula et al29 reported associations between VEGF, semaphorin 3A, vascular tortuosity, and electrophysiologic sensitivity variables of rods and the postreceptor retina in the 50/10 OIR model, suggesting that the postreceptor retina mediates vascular abnormalities in the model. We report herein that the NPs are upregulated in association with peripheral avascular retina and intravitreous neovascularization. Both NPs can function as receptors for several VEGF family members, including placental growth factor 1, VEGFB, and isoforms VEGF164/165 and VEGF145.30 Less is known about PEDFR signaling.25 However, counter to the anticipated role of PEDF as an angiogenic inhibitor, PEDF knockout mice developed larger areas of vasoobliteration following hyperoxia than wild-type littermates.31 Compared with RA, we found increased fold change in PEDFR mRNA expression at p14 associated with persistent peripheral avascular retina in the 50/10 OIR model. This finding may be important in the development of peripheral avascular retina because PEDF is an inhibitor of angiogenesis.28

Arterial oxygen levels13 in the 50/10 OIR model are similar to transcutaneous oxygen levels measured in preterm infants who develop severe ROP12; the model uses repeated oxygen fluctuations, a risk for ROP,11,12 rather than constant oxygen used in other models.14,28,32,33 As in zone 2, stage 3 ROP, in which fluorescein angiograms demonstrate reduced peripheral retinal vascularization and perfusion with minimal central vascular retraction,34 there is peripheral avascular retina and minimal central obliteration in the 50/10 OIR model.13 The 50/10 OIR model reproducibly and consistently develops vessel tortuosity (analogous to plus disease),35,36 peripheral avascular retina at p14 (analogous to human zone 2 ROP),13,36 and subsequently intravitreous neovascularization at the junction of vascular and avascular retina (analogous to human stage 3 ROP).37 Other models of oxygen-induced retinopathy, including the mouse model, use oxygen levels higher than those in neonatal intensive care units in the United States and create central rather than peripheral avascular retina.

There are several possible explanations for our findings. At p14, VEGF expression may be increased as a result of previous exposure to 10% oxygen. We used real-time PCR to measure expression because it is the most quantitative method available. High VEGF mRNA expression is consistent with later development of intravitreous neovascularization at p18 but does not explain why blood vessel growth occurs into the vitreous rather than into the retina. Loss of the physiologic gradient of VEGF in the retina may be why blood vessels grow into the vitreous. However, Geisen et al38 measured vitreous VEGF and retinal VEGF in the 50/10 OIR model and found that vitreous levels were one-tenth those of retinal levels at p18, failing to provide support for a gradient of VEGF toward the vitreous and away from the retina. It is also possible that at p14 the model is moving toward a vasoproliferative phase. However, several studies found that inhibition of VEGF bioactivity using a neutralizing antibody38 or a VEGFR2 kinase inhibitor39 reduced angiogenesis into the vitreous (intravitreous neovascularization) but did not interfere with angiogenesis into the retina (intraretinal vascularization). Excessive signaling through VEGFR2 has been shown to interfere with developmental angiogenesis in other models.40 Increased signaling through VEGFRs may disorder and interfere with developmental angiogenesis. This might delay normal vascularization and contribute to peripheral avascular retina. However, because VEGF is also a neuronal survival factor,4,5 there is concern about possible systemic adverse effects of anti-VEGF agents that are absorbed into the bloodstream of the developing preterm infant.

Although measurement of mRNA expression by real-time PCR provides the most quantitative data, it does not always correspond to the concentration of translated proteins or activated proteins involved in signaling pathways. Further study in these areas is warranted.

In summary, expression of VEGF164 and its receptors and coreceptors was increased in the 50/10 OIR model at p14 in association with persistent peripheral avascular retina compared with that in RA at p14, when retinal vascularization was complete. We propose that overexpression of VEGF may interfere with retinal vascular development and contribute to peripheral avascular retina. We also found that VEGF164 was increased in the 50/10 OIR model at p18 in association with intravitreous neovascularization. Increased PEDFR expression in the 50/10 OIR model compared with RA may also have a role in contributing to peripheral avascular retina.

Correspondence: M. Elizabeth Hartnett, MD, Department of Ophthalmology, School of Medicine, University of North Carolina, 130 Mason Farm Rd, Campus Box 7040, Chapel Hill, NC 27599-7040 (hartnet@med.unc.edu).

Submitted for Publication: April 8, 2009; final revision received July 1, 2009; accepted August 19, 2009.

Author Contributions: Dr Hartnett had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Financial Disclosure: Dr Hartnett is a clinical trial development consultant for Ophthalmic Research Associates (Andover, Massachusetts), which had no involvement in the study.

Funding/Support: This study was supported by grants EY015130 and EY017011 from the National Eye Institute, March of Dimes, American Diabetes Association, and a Research to Prevent Blindness Physician Scientist Award (Dr Hartnett).

Role of the Sponsor: Ophthalmic Research Associates had no role in the design and conduct of the study; in the collection, analysis, and interpretation of the data; or in the preparation, review, or approval of the manuscript.

Additional Information: This article contains some data points from Figures 3 through 5 and 8 from a thesis that was prepared in partial fulfillment of the requirements for membership in the America Ophthalmological Society and is anticipated to be published in the Transactions of the American Ophthalmological Society (the data referred to are references within the “Results” section).

Neufeld  GKessler  O The semaphorins: versatile regulators of tumour progression and tumour angiogenesis. Nat Rev Cancer 2008;8 (8) 632- 645
PubMed Link to Article
Chan-Ling  TGock  BStone  J The effect of oxygen on vasoformative cell division: evidence that ‘physiological hypoxia’ is the stimulus for normal retinal vasculogenesis. Invest Ophthalmol Vis Sci 1995;36 (7) 1201- 1214
PubMed
Stone  JItin  AAlon  T  et al.  Development of retinal vasculature is mediated by hypoxia-induced vascular endothelial growth factor (VEGF) expression by neuroglia. J Neurosci 1995;15 (7, pt 1) 4738- 4747
PubMed
Nishijima  KNg  YSZhong  L  et al.  Vascular endothelial growth factor–A is a survival factor for retinal neurons and a critical neuroprotectant during the adaptive response to ischemic injury. m J Pathol 2007;171 (1) 53- 67
PubMed
Oosthuyse  BMoons  LStorkebaum  E  et al.  Deletion of the hypoxia-response element in the vascular endothelial growth factor promoter causes motor neuron degeneration. Nat Genet 2001;28 (2) 131- 138
PubMed Link to Article
Tombran-Tink  JBarnstable  CJ PEDF: a multifaceted neurotrophic factor. Nat Rev Neurosci 2003;4 (8) 628- 636
PubMed Link to Article
Dawson  DWVolpert  OVGillis  P  et al.  Pigment epithelium–derived factor: a potent inhibitor of angiogenesis. Science 1999;285 (5425) 245- 248
PubMed Link to Article
Zhang  SXWang  JJGao  GParke  KMa  JX Pigment epithelium–derived factor downregulates vascular endothelial growth factor (VEGF) expression and inhibits VEGF–VEGF receptor 2 binding in diabetic retinopathy. J Mol Endocrinol 2006;37 (1) 1- 12
PubMed Link to Article
Shibuya  M Differential roles of vascular endothelial growth factor receptor–1 and receptor–2 in angiogenesis. J Biochem Mol Biol 2006;39 (5) 469- 478
Link to Article
McColm  JRGeisen  PHartnett  ME VEGF isoforms and their expression after a single episode of hypoxia or repeated fluctuations between hyperoxia and hypoxia: relevance to clinical ROP. Mol Vis 2004;10512- 520
PubMed
Tin  WMilligan  DWAPennefather  PMHey  E Pulse oximetry, severe retinopathy, and outcome at one year in babies of less than 28 weeks gestation. Arch Dis Child Fetal Neonatal Ed 2001;84106- 110
Link to Article
Cunningham  SFleck  BWElton  RA McIntosh  N Transcutaneous oxygen levels in retinopathy of prematurity. Lancet 1995;346 (8988) 1464- 1465
PubMed Link to Article
Penn  JSHenry  MMTolman  BL Exposure to alternating hypoxia and hyperoxia causes severe proliferative retinopathy in the newborn rat. Pediatr Res 1994;36 (6) 724- 731
PubMed Link to Article
Smith  LEWesolowski  E McLellan  A  et al.  Oxygen-induced retinopathy in the mouse. Invest Ophthalmol Vis Sci 1994;35 (1) 101- 111
PubMed
Pierce  EAFoley  EDSmith  LE Regulation of vascular endothelial growth factor by oxygen in a model of retinopathy of prematurity [published correction appears in Arch Ophthalmol. 1997;115(3):427]. Arch Ophthalmol 1996;114 (10) 1219- 1228
PubMed Link to Article
Shih  SCJu  MLiu  NSmith  LE Selective stimulation of VEGFR-1 prevents oxygen-induced retinal vascular degeneration in retinopathy of prematurity. J Clin Invest 2003;112 (1) 50- 57
PubMed Link to Article
Chang  KHChan-Ling  T McFarland  EL  et al.  IGF binding protein–3 regulates hematopoietic stem cell and endothelial precursor cell function during vascular development. Proc Natl Acad Sci U S A 2007;104 (25) 10595- 10600
PubMed Link to Article
Lofqvist  CChen  JConnor  KM  et al.  IGFBP3 suppresses retinopathy through suppression of oxygen-induced vessel loss and promotion of vascular regrowth. Proc Natl Acad Sci U S A 2007;104 (25) 10589- 10594
PubMed Link to Article
Connor  KMSanGiovanni  JPLofqvist  C  et al.  Increased dietary intake of ω-3-polyunsaturated fatty acids reduces pathological retinal angiogenesis. Nat Med 2007;13 (7) 868- 873
PubMed Link to Article
Neu  JAfzal  APan  H  et al.  The dipeptide Arg-Gln inhibits retinal neovascularization in the mouse model of oxygen-induced retinopathy. Invest Ophthalmol Vis Sci 2006;47 (7) 3151- 3155
PubMed Link to Article
Pierce  EAAvery  RLFoley  EDAiello  LPSmith  LEH Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization. Proc Natl Acad Sci U S A 1995;92 (3) 905- 909
PubMed Link to Article
Robinson  GSPierce  EARook  SLFoley  EWebb  RSmith  LE Oligodeoxynucleotides inhibit retinal neovascularization in a murine model of proliferative retinopathy. Proc Natl Acad Sci U S A 1996;93 (10) 4851- 4856
PubMed Link to Article
Werdich  XQPenn  JS Specific involvement of Src family kinase activation in the pathogenesis of retinal neovascularization. Invest Ophthalmol Vis Sci 2006;47 (11) 5047- 5056
PubMed Link to Article
Chan-Ling  T Glial, vascular and neuronal cytogenesis in whole-mounted cat retina. Microsc Res Tech 1997;36 (1) 1- 16
PubMed Link to Article
Notari  LBaladron  VAroca-Aguilar  JD  et al.  Identification of a lipase-linked cell membrane receptor for pigment epithelium–derived factor. J Biol Chem 2006;281 (49) 38022- 38037
PubMed Link to Article
Saito  YGeisen  PUppal  AHartnett  ME Inhibition of NAD(P)H oxidase reduces apoptosis and avascular retina in an animal model of retinopathy of prematurity. Mol Vis 2007;13840- 853
PubMed
Ferrara  NGerber  HPLeCouter  J The biology of VEGF and its receptors. Nat Med 2003;9 (6) 669- 676
PubMed Link to Article
Gao  GLi  YZhang  DGee  SCrosson  CMa  J Unbalanced expression of VEGF and PEDF in ischemia-induced retinal neovascularization. FEBS Lett 2001;489 (2-3) 270- 276
PubMed Link to Article
Akula  JDMocko  JABenador  IY  et al.  The neurovascular relation in oxygen-induced retinopathy. Mol Vis 2008;142499- 2508
PubMed
Bachelder  RELipscomb  EALin  X  et al.  Competing autocrine pathways involving alternative neuropilin-1 ligands regulate chemotaxis of carcinoma cells. Cancer Res 2003;63 (17) 5230- 5233
PubMed
Huang  QWang  SSorenson  CMSheibani  N PEDF-deficient mice exhibit an enhanced rate of retinal vascular expansion and are more sensitive to hyperoxia-mediated vessel obliteration. Exp Eye Res 2008;87 (3) 226- 241
PubMed Link to Article
Ernest  JTGoldstick  TK Retinal oxygen tension and oxygen reactivity in retinopathy of prematurity in kittens. Invest Ophthalmol Vis Sci 1984;25 (10) 1129- 1134
PubMed
McLeod  DSCrone  SNLutty  GA Vasoproliferation in the neonatal dog model of oxygen-induced retinopathy. Invest Ophthalmol Vis Sci 1996;37 (7) 1322- 1333
PubMed
Lepore  DPagliara  MMBaldascino  A  et al.  Classification of fluorescein angiographic findings in threshold and prethreshold ROP [abstract]. Invest Ophthalmol Vis Sci 2008; ((suppl 49)) 1407
PubMed
Liu  KAkula  JDFalk  CHansen  RMFulton  AB The retinal vasculature and function of the neural retina in a rat model of retinopathy of prematurity. Invest Ophthalmol Vis Sci 2006;47 (6) 2639- 2647
PubMed Link to Article
Hartnett  MEMartiniuk  DJByfield  GEGeisen  PZeng  GBautch  VL Neutralizing VEGF decreases tortuosity and alters endothelial cell division orientation in arterioles and veins in rat model of ROP: relevance to plus disease. Invest Ophthalmol Vis Sci 2008;49 (7) 3107- 3114
PubMed Link to Article
Penn  JSTolman  BLHenry  MM Oxygen-induced retinopathy in the rat: relationship of retinal nonperfusion to subsequent neovascularization. Invest Ophthalmol Vis Sci 1994;35 (9) 3429- 3435
PubMed
Geisen  PPeterson  LJMartiniuk  DUppal  ASaito  YHartnett  ME Neutralizing antibody to VEGF reduces intravitreous neovascularization and may not interfere with ongoing intraretinal vascularization in a rat model of retinopathy of prematurity. Mol Vis 2008;14345- 357
PubMed
Budd  SByfield  GMartiniuk  DGeisen  PHartnett  ME Reduction in endothelial tip cell filopodia corresponds to reduced intravitreous but not intraretinal vascularization in a model of ROP. Exp Eye Res 2009;89 (5) 718- 727
PubMed Link to Article
Zeng  GTaylor  SM McColm  JR  et al.  Orientation of endothelial cell division is regulated by VEGF signaling during blood vessel formation. Blood 2007;109 (4) 1345- 1352
PubMed Link to Article

Figures

Place holder to copy figure label and caption
Figure 1.

Lectin-stained retinal flat mount from a rat pup at postnatal age 14 days in the 50/10 oxygen–induced rat model of retinopathy of prematurity following 7 cycles of oxygen fluctuations every 24 hours between 50% oxygen and 10% oxygen. Peripheral avascular retina persists, whereas room air–raised rat pup counterparts have fully vascularized retina.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 2.

Lectin-stained retinal flat mount from a rat pup at postnatal age 18 days in the 50/10 oxygen–induced rat model of retinopathy of prematurity (7 cycles of oxygen fluctuations every 24 hours between 50% oxygen and 10% oxygen, followed by 4 days in room air). Intravitreous neovascularization exists at the junction of vascular and avascular retina.

Graphic Jump Location
Place holder to copy figure label and caption
Figure 3.

Fold change in isoform vascular endothelial growth factor 164 (VEGF164) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in VEGF164 mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P < .001) and at 18 days (**P = .02) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 4.

Fold change in vascular endothelial growth factor receptor 2 (VEGFR2) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in VEGFR2 mRNA expression was present in 50/10 OIR compared with RA at 18 days (*P = .004). A trend toward increased fold change in VEGFR2 mRNA expression was noted in the 50/10 OIR model at 14 days (P = .06) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 5.

Fold change in vascular endothelial growth factor receptor (VEGFR1) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). No significant differences were found at 14 days (P = .47) or at 18 days (P = .97) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 6.

Fold change in neuropilin 1 (NP1) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in NP1 mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P = .04) and at 18 days (**P = .03) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 7.

Fold change in neuropilin 2 (NP2) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in NP2 mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P = .001) and at 18 days (**P = .002) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 8.

Fold change in pigment epithelium–derived factor (PEDF) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). No significant difference was found at 14 days (P = .47) or at 18 days (P = .39) (t test).

Graphic Jump Location
Place holder to copy figure label and caption
Figure 9.

Fold change in pigment epithelium–derived factor receptor (PEDFR) messenger RNA (mRNA) expression, relative to β-actin, in room air–raised rat pups (RA) and the 50/10 oxygen–induced rat model of retinopathy of prematurity (50/10 OIR model). Significantly increased fold change in PEDFR mRNA expression was present in the 50/10 OIR model compared with RA at 14 days (*P < .001). No significant difference was found at 18 days (P = .32) (t test).

Graphic Jump Location

Tables

References

Neufeld  GKessler  O The semaphorins: versatile regulators of tumour progression and tumour angiogenesis. Nat Rev Cancer 2008;8 (8) 632- 645
PubMed Link to Article
Chan-Ling  TGock  BStone  J The effect of oxygen on vasoformative cell division: evidence that ‘physiological hypoxia’ is the stimulus for normal retinal vasculogenesis. Invest Ophthalmol Vis Sci 1995;36 (7) 1201- 1214
PubMed
Stone  JItin  AAlon  T  et al.  Development of retinal vasculature is mediated by hypoxia-induced vascular endothelial growth factor (VEGF) expression by neuroglia. J Neurosci 1995;15 (7, pt 1) 4738- 4747
PubMed
Nishijima  KNg  YSZhong  L  et al.  Vascular endothelial growth factor–A is a survival factor for retinal neurons and a critical neuroprotectant during the adaptive response to ischemic injury. m J Pathol 2007;171 (1) 53- 67
PubMed
Oosthuyse  BMoons  LStorkebaum  E  et al.  Deletion of the hypoxia-response element in the vascular endothelial growth factor promoter causes motor neuron degeneration. Nat Genet 2001;28 (2) 131- 138
PubMed Link to Article
Tombran-Tink  JBarnstable  CJ PEDF: a multifaceted neurotrophic factor. Nat Rev Neurosci 2003;4 (8) 628- 636
PubMed Link to Article
Dawson  DWVolpert  OVGillis  P  et al.  Pigment epithelium–derived factor: a potent inhibitor of angiogenesis. Science 1999;285 (5425) 245- 248
PubMed Link to Article
Zhang  SXWang  JJGao  GParke  KMa  JX Pigment epithelium–derived factor downregulates vascular endothelial growth factor (VEGF) expression and inhibits VEGF–VEGF receptor 2 binding in diabetic retinopathy. J Mol Endocrinol 2006;37 (1) 1- 12
PubMed Link to Article
Shibuya  M Differential roles of vascular endothelial growth factor receptor–1 and receptor–2 in angiogenesis. J Biochem Mol Biol 2006;39 (5) 469- 478
Link to Article
McColm  JRGeisen  PHartnett  ME VEGF isoforms and their expression after a single episode of hypoxia or repeated fluctuations between hyperoxia and hypoxia: relevance to clinical ROP. Mol Vis 2004;10512- 520
PubMed
Tin  WMilligan  DWAPennefather  PMHey  E Pulse oximetry, severe retinopathy, and outcome at one year in babies of less than 28 weeks gestation. Arch Dis Child Fetal Neonatal Ed 2001;84106- 110
Link to Article
Cunningham  SFleck  BWElton  RA McIntosh  N Transcutaneous oxygen levels in retinopathy of prematurity. Lancet 1995;346 (8988) 1464- 1465
PubMed Link to Article
Penn  JSHenry  MMTolman  BL Exposure to alternating hypoxia and hyperoxia causes severe proliferative retinopathy in the newborn rat. Pediatr Res 1994;36 (6) 724- 731
PubMed Link to Article
Smith  LEWesolowski  E McLellan  A  et al.  Oxygen-induced retinopathy in the mouse. Invest Ophthalmol Vis Sci 1994;35 (1) 101- 111
PubMed
Pierce  EAFoley  EDSmith  LE Regulation of vascular endothelial growth factor by oxygen in a model of retinopathy of prematurity [published correction appears in Arch Ophthalmol. 1997;115(3):427]. Arch Ophthalmol 1996;114 (10) 1219- 1228
PubMed Link to Article
Shih  SCJu  MLiu  NSmith  LE Selective stimulation of VEGFR-1 prevents oxygen-induced retinal vascular degeneration in retinopathy of prematurity. J Clin Invest 2003;112 (1) 50- 57
PubMed Link to Article
Chang  KHChan-Ling  T McFarland  EL  et al.  IGF binding protein–3 regulates hematopoietic stem cell and endothelial precursor cell function during vascular development. Proc Natl Acad Sci U S A 2007;104 (25) 10595- 10600
PubMed Link to Article
Lofqvist  CChen  JConnor  KM  et al.  IGFBP3 suppresses retinopathy through suppression of oxygen-induced vessel loss and promotion of vascular regrowth. Proc Natl Acad Sci U S A 2007;104 (25) 10589- 10594
PubMed Link to Article
Connor  KMSanGiovanni  JPLofqvist  C  et al.  Increased dietary intake of ω-3-polyunsaturated fatty acids reduces pathological retinal angiogenesis. Nat Med 2007;13 (7) 868- 873
PubMed Link to Article
Neu  JAfzal  APan  H  et al.  The dipeptide Arg-Gln inhibits retinal neovascularization in the mouse model of oxygen-induced retinopathy. Invest Ophthalmol Vis Sci 2006;47 (7) 3151- 3155
PubMed Link to Article
Pierce  EAAvery  RLFoley  EDAiello  LPSmith  LEH Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization. Proc Natl Acad Sci U S A 1995;92 (3) 905- 909
PubMed Link to Article
Robinson  GSPierce  EARook  SLFoley  EWebb  RSmith  LE Oligodeoxynucleotides inhibit retinal neovascularization in a murine model of proliferative retinopathy. Proc Natl Acad Sci U S A 1996;93 (10) 4851- 4856
PubMed Link to Article
Werdich  XQPenn  JS Specific involvement of Src family kinase activation in the pathogenesis of retinal neovascularization. Invest Ophthalmol Vis Sci 2006;47 (11) 5047- 5056
PubMed Link to Article
Chan-Ling  T Glial, vascular and neuronal cytogenesis in whole-mounted cat retina. Microsc Res Tech 1997;36 (1) 1- 16
PubMed Link to Article
Notari  LBaladron  VAroca-Aguilar  JD  et al.  Identification of a lipase-linked cell membrane receptor for pigment epithelium–derived factor. J Biol Chem 2006;281 (49) 38022- 38037
PubMed Link to Article
Saito  YGeisen  PUppal  AHartnett  ME Inhibition of NAD(P)H oxidase reduces apoptosis and avascular retina in an animal model of retinopathy of prematurity. Mol Vis 2007;13840- 853
PubMed
Ferrara  NGerber  HPLeCouter  J The biology of VEGF and its receptors. Nat Med 2003;9 (6) 669- 676
PubMed Link to Article
Gao  GLi  YZhang  DGee  SCrosson  CMa  J Unbalanced expression of VEGF and PEDF in ischemia-induced retinal neovascularization. FEBS Lett 2001;489 (2-3) 270- 276
PubMed Link to Article
Akula  JDMocko  JABenador  IY  et al.  The neurovascular relation in oxygen-induced retinopathy. Mol Vis 2008;142499- 2508
PubMed
Bachelder  RELipscomb  EALin  X  et al.  Competing autocrine pathways involving alternative neuropilin-1 ligands regulate chemotaxis of carcinoma cells. Cancer Res 2003;63 (17) 5230- 5233
PubMed
Huang  QWang  SSorenson  CMSheibani  N PEDF-deficient mice exhibit an enhanced rate of retinal vascular expansion and are more sensitive to hyperoxia-mediated vessel obliteration. Exp Eye Res 2008;87 (3) 226- 241
PubMed Link to Article
Ernest  JTGoldstick  TK Retinal oxygen tension and oxygen reactivity in retinopathy of prematurity in kittens. Invest Ophthalmol Vis Sci 1984;25 (10) 1129- 1134
PubMed
McLeod  DSCrone  SNLutty  GA Vasoproliferation in the neonatal dog model of oxygen-induced retinopathy. Invest Ophthalmol Vis Sci 1996;37 (7) 1322- 1333
PubMed
Lepore  DPagliara  MMBaldascino  A  et al.  Classification of fluorescein angiographic findings in threshold and prethreshold ROP [abstract]. Invest Ophthalmol Vis Sci 2008; ((suppl 49)) 1407
PubMed
Liu  KAkula  JDFalk  CHansen  RMFulton  AB The retinal vasculature and function of the neural retina in a rat model of retinopathy of prematurity. Invest Ophthalmol Vis Sci 2006;47 (6) 2639- 2647
PubMed Link to Article
Hartnett  MEMartiniuk  DJByfield  GEGeisen  PZeng  GBautch  VL Neutralizing VEGF decreases tortuosity and alters endothelial cell division orientation in arterioles and veins in rat model of ROP: relevance to plus disease. Invest Ophthalmol Vis Sci 2008;49 (7) 3107- 3114
PubMed Link to Article
Penn  JSTolman  BLHenry  MM Oxygen-induced retinopathy in the rat: relationship of retinal nonperfusion to subsequent neovascularization. Invest Ophthalmol Vis Sci 1994;35 (9) 3429- 3435
PubMed
Geisen  PPeterson  LJMartiniuk  DUppal  ASaito  YHartnett  ME Neutralizing antibody to VEGF reduces intravitreous neovascularization and may not interfere with ongoing intraretinal vascularization in a rat model of retinopathy of prematurity. Mol Vis 2008;14345- 357
PubMed
Budd  SByfield  GMartiniuk  DGeisen  PHartnett  ME Reduction in endothelial tip cell filopodia corresponds to reduced intravitreous but not intraretinal vascularization in a model of ROP. Exp Eye Res 2009;89 (5) 718- 727
PubMed Link to Article
Zeng  GTaylor  SM McColm  JR  et al.  Orientation of endothelial cell division is regulated by VEGF signaling during blood vessel formation. Blood 2007;109 (4) 1345- 1352
PubMed Link to Article

Correspondence

CME
Meets CME requirements for:
Browse CME for all U.S. States
Accreditation Information
The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians. The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity. Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
Commitment to Change (optional):
Indicate what change(s) you will implement in your practice, if any, based on this CME course.
Your quiz results:
The filled radio buttons indicate your responses. The preferred responses are highlighted
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
Submit a Comment

Multimedia

Some tools below are only available to our subscribers or users with an online account.

Web of Science® Times Cited: 12

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Collections