0
Laboratory Sciences |

A Role for Connective Tissue Growth Factor in the Pathogenesis of Choroidal Neovascularization FREE

Shikun He, MD; Man Lin Jin, MD, PhD; Vanessa Worpel, MD; David R. Hinton, MD, FRCPC
[+] Author Affiliations

Copyright 2003 American Medical Association. All Rights Reserved. Applicable FARS/DFARS Restrictions Apply to Government Use.

More Author Information
Arch Ophthalmol. 2003;121(9):1283-1288. doi:10.1001/archopht.121.9.1283
Text Size: A A A
Published online

Objective  To evaluate the expression of connective tissue growth factor (CTGF) in choroidal neovascular membranes from patients with age-related macular degeneration and the effect of CTGF on choroidal endothelial cell (CEC) function.

Methods  Using immunohistochemical methods, we analyzed CTGF expression in 13 surgically excised choroidal neovascular membranes related to age-related macular degeneration. The expression of CTGF in retinal pigment epithelial and CEC cultures was determined by means of reverse transcriptase polymerase chain reaction and Western blot, and its regulation by vascular endothelial growth factor and transforming growth factor β was determined. The effects of CTGF on bovine CEC proliferation, attachment, migration, and tube formation were measured.

Results  Vascularized human choroidal neovascular membranes showed strong CTGF immunoreactivity. Double staining disclosed colocalization of CTGF with retinal pigment epithelial cells and CECs. The CTGF induced a significant increase in attachment and migration of CECs; however, it did not stimulate CEC proliferation. The CTGF protein was up-regulated in retinal pigment epithelial cells and CECs by stimulation with transforming growth factor β and vascular endothelial growth factor, respectively.

Conclusions  The expression of CTGF in choroidal neovascular membranes, its regulation by angiogenic growth factors, and its proangiogenic effects on CEC function suggest that CTGF may play a role in the pathogenesis of choroidal neovascularization.

Clinical Relevance  Multiple growth factors are involved in the pathogenesis of choroidal neovascularization in age-related macular degeneration.

Figures in this Article

AGE-RELATED MACULAR degeneration is the leading cause of lost reading vision in the elderly population.1 The exudative form of the disease, characterized by choroidal neovascularization, is the major cause of severe vision loss in this disorder.1 - 2 The pathogenesis of choroidal neovascularization is a complex process that involves growth factor–mediated alterations in choroidal endothelial cell (CEC) function and remodeling of the extracellular matrix, resulting in the development of a fibrovascular subretinal membrane.3 - 6

Experimental evidence suggests that retinal pigment epithelial (RPE) cells play a key role in the development of choroidal neovascularization.7 - 9 A number of angiogenic factors produced by RPE and localized to human choroidal neovascular membranes(CNVMs) have been identified, including fibroblast growth factor, platelet-derived growth factor, vascular endothelial growth factor (VEGF), transforming growth factor β (TGF-β), angiopoietin 1, and angiopoietin 2.9 - 13

The secreted, cysteine-rich polypeptide connective tissue growth factor(CTGF) was originally identified from conditioned medium of human umbilical vein endothelial cells.14 It is expressed in a variety of cells, including fibroblasts, epithelial cells, and smooth muscle cells. It is highly expressed in active endothelial cells and vessels, as well as in scars, fibrotic lesions, and atherosclerotic lesions.15 - 16 This angiogenic factor was recently found to induce endothelial cell migration, proliferation, and tube formation and to increase endothelial cell attachment.17 Application of recombinant CTGF in rat and chicken embryos induces angiogenic responses in vivo.17 - 18 Antisense deoxynucleotides directed against CTGF inhibit endothelial cell tube formation, 19 and anti-CTGF antibody blocks in vivo angiogenesis induced by recombinant CTGF.19 This suggests that CTGF could play an important role in angiogenesis by regulating endothelial cell function.

The role of CTGF in ocular angiogenesis is currently under investigation. Recent publications report that VEGF up-regulates CTGF messenger RNA (m RNA)expression in retinal endothelial cells.20 - 21 However, to the best of our knowledge, there have been no reports about the role of CTGF in the pathogenesis of choroidal neovascularization and no studies of CTGF effects on CECs. It is important to specifically study CECs, since endothelial cell heterogeneity is well described in vivo and in vitro, and there are marked functional differences between CECs and endothelial cells from other regions.22 - 25

In the present study, we show that CTGF expression is present in CNVMs of patients with age-related macular degeneration. We then demonstrate that CTGF m RNA is expressed in RPE cells and CECs and that the production of CTGF protein is up-regulated in RPE cells and CECs by stimulation with TGF-β and VEGF, respectively. Furthermore, we show that CTGF induces proangiogenic responses in CECs in vitro.

IMMUNOHISTOCHEMICAL STAINING

Thirteen surgically excised subfoveal CNVMs from patients with age-related macular degeneration (aged 66-85 years) and 3 normal adult postmortem donor retinas (from the Lions Doheny Eye Bank, aged 55-97 years) were prepared for immunostaining. The study was approved by the institutional review board of the University of Southern California, Los Angeles. Five of the membranes were predominantly vascular, 5 were predominantly fibrotic, and 3 were mixed in appearance. Tissues were snap frozen and sectioned at 6 µm with the cryostat. Thawed tissue sections were air dried, rehydrated with phosphate-buffered saline (p H 7.4), and blocked with 5% normal goat serum for 15 minutes. Sections were incubated with anti-CTGF polyclonal antibody (Fibro Gen, Inc, South San Francisco, Calif) for 60 minutes and then treated with biotinylated secondary anti–rabbit antibody (1:400; Vector Laboratories, Burlingame, Calif) followed by streptavidin peroxidase. The red color was developed with an aminoethyl carbazole kit (Zymed Laboratories, Inc, South San Francisco). After each step, sections were given three 5-minute washes with phosphate-buffered saline. Slides were counterstained with hematoxylin and mounted with glycerin-gelatin medium. Controls for the immunoperoxidase studies included (1) staining of adjacent tissue sections by means of an identical protocol except that the primary antibody was omitted and (2) staining of adjacent tissue sections with an identical protocol with the use of antiserum preadsorbed with recombinant CTGF. In both controls, negligible background or nonspecific staining was found (Figure 1C and F).

Place holder to copy figure label and caption
Figure 1

A, C and D, Immunoperoxidase staining of surgically excised choroidal neovascular membranes for connective tissue growth factor (CTGF) with the use of aminoethyl carbazole as the chromogen(red) and a hematoxylin (blue) nuclear counterstain. The melanin pigment appears brown. In A, a vascular membrane shows typical stromal cells positive for CTGF (arrows). In C and D, a fibrotic membrane is seen with attached residual retinal pigment epithelial monolayer overlying a thickened Bruch membrane. Note that occasional residual retinal pigment epithelial cells are strongly positive for CTGF (D, arrow at top). Stromal cells are also CTGF positive(C, D, arrows in lower half). B, E, Double immunoperoxidase stains for CTGF(red) and cell-specific markers (blue) with no counterstain. In B, several cells double label for CTGF (red) and cytokeratin (blue), indicating colocalization in cells derived from retinal pigment epithelium (arrows). In E, cells lining vascular spaces double label with CTGF (red) and CD31 (blue), indicating colocalization in endothelial cells (arrow). F, A section adjacent to that shown in C is stained in the same manner as in C, except that the primary CTGF antiserum was preadsorbed with recombinant CTGF. Note that F shows only negligible background staining. Digital images were obtained with a digital camera (SPOT; Diagnostic Instruments Incorporated, Sterling Heights, Mich) mounted on a photomicroscope(Olympus America Inc, Melville, NY) (for all, original magnification Ă—500).

Grahic Jump Location
DOUBLE IMMUNOPEROXIDASE AND ALKALINE PHOSPHATASE STAINING

Thawed tissue sections were fixed for 10 minutes with 10% neutral buffered formalin (Polysciences, Inc, Warrington, Pa), given three 5-minute washes with Tris hydrochloride buffer (p H 7.4), and blocked with 5% goat serum for 15 minutes. After cells were immunostained for CTGF as described above, the slides were washed with the Tris buffer 3 times. Primary antibodies were added to cover the tissue, and the slides were incubated for 1 hour at room temperature. The sections were washed 3 times with Tris buffer, and secondary alkaline phosphatase anti–mouse antibody (Vector Laboratories) was added for 30 minutes. After another triple wash with Tris buffer, an alkaline phosphatase chromogen substrate (Vector Blue; Vector Laboratories) was added to the slides for 15 minutes for color development.

ISOLATION OF RPE CELLS AND CECs

Human RPE cells were obtained from human fetal eyes (18-26 weeks of gestation; Advanced Bioscience Resources, Inc, Alameda, Calif).26 Second- through fourth-passage cells were used for all experiments. The RPE cells were cultured in Dulbecco modified Eagle medium (Fisher Scientific, Pittsburgh, Pa) supplemented with 10% fetal bovine serum (Gibco BRL, Gaithersburg, Md), 2m M glutamine, 100-µg/mL streptomycin, and 100-U/mL penicillin (Sigma-Aldrich Corp, St Louis, Mo). The purity of cultured RPE cells was confirmed by means of immunocytochemical staining; more than 95% of cells were positive for cytokeratin(DAKO, Carpinteria, Calif), while no cells were positive for the endothelial cell antigen von Willebrand factor (DAKO) or macrophage antigen CD11c (DAKO). Magnetic beads carrying the specific endothelial marker Lycopersicon esculentum (Sigma-Aldrich Corp) were used to isolate CECs from bovine eyes, as previously described.27 Positive immunostaining for von Willebrand factor and binding of diacetylated low-density lipoprotein confirmed that the CECs were vascular endothelial cells. Although it is likely that the distinct functional characteristics of CECs may be lost after prolonged passage, previous work has shown that low-passage endothelial cells of diverse origin retain functional and structural differences.25 In our experiments, all CECs were in passage 2 or 3.

REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

Poly A (A)+RNA was isolated by means of a kit (Fast Track; Invitrogen Corp, Carlsbad, Calif). First-strand complementary DNA was synthesized at 42°C with Moloney murine leukemia virus reverse transcriptase (Gibco BRL). The polymerase chain reaction was initiated in a DNA thermal cycler (Perkin-Elmer/Cetus, Norwalk, Conn) with CTGF primer pairs (human CTGF: GCATCCGTACTCCCAAAATC [sense] and CTTCTTCATGACCTCGCCGT [antisense]; bovine CTGF: GATCATAGGACTGTATTAGTGC[sense] and CTGACTTAGAGACGAACTTG [antisense]). After 30 cycles of polymerase chain reaction, the products were resolved on a 1.2% agarose gel and stained with ethidium bromide, and the gel was photographed under ultraviolet illumination.

WESTERN BLOT ANALYSIS

The RPE cells and CECs were grown in 6-well plates and starved for 24 hours in Dulbecco modified Eagle medium or essential growth media (Bio Whittaker, Walkersville, Md) with 0.1% bovine serum albumin. The medium was then removed and replaced with fresh medium. For stimulation studies, the CEC replacement medium included 1% fetal bovine serum and recombinant VEGF (10-50 ng/mL); for RPE cells, the medium was serum-free and included TGF-β2 (1-30 ng/mL). Lysed cells were collected after 48 hours of additional incubation; proteins were resolved on Tris hydrochloride 10% polyacrylamide gels (Ready Gel; Bio-Rad Laboratories, Hercules, Calif) at 120 V, with 8 µg of protein added to each lane. The proteins were transferred to a polyvinylidene fluoride blotting membrane (Millipore, Billerica, Mass); these membranes were then probed with polyclonal anti-CTGF antibody (Fibro Gen, Inc), followed by horseradish peroxidase–conjugated goat anti–rabbit antibody (Vector Laboratories) for 30 minutes at room temperature. Images were developed by adding chemiluminescence detection solution (ECL; Amersham Pharmacia Biotech, Piscataway, NJ).

ATTACHMENT AND MIGRATION ASSAYS

The RPE cells or CECs (105/mL) were trypsinized and resuspended in cell culture medium with 0.4% fetal bovine serum. After a 48-hour treatment with CTGF, 100 mL of cell suspension (104 cells) was added to each well of a 96-well fibronectin-coated plate (Becton, Dickinson Labware, Bedford, Mass), and cells were allowed to attach for 60 minutes.26 The cells were gently washed twice with phosphate-buffered saline, and fresh medium(150 mL) was added to each well with 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide, 5 mg/mL, 20 mL (Sigma-Aldrich Corp). After a 5-hour incubation, the supernatants were decanted; the formazan precipitates were solubilized by adding 150 mL of 100% dimethyl sulfoxide (Sigma-Aldrich Corp) and placed on a plate shaker for 10 minutes. Absorbance at 550 nm was determined on a microplate reader (Benchmark Microplate Reader; Bio-Rad Laboratories).

Migration of RPE cells and CECs was measured by means of a modified Boyden chamber assay in 24-well plates with fibronectin-coated inserts.26 Recombinant CTGF, 10 to 50 ng/mL (Fibro Gen, Inc), was added to the lower chamber as the stimulant. After a 5-hour incubation, the inserts were washed 3 times with phosphate-buffered saline, fixed with cold (4°C) methanol for 10 minutes, and counterstained with hematoxylin for 20 minutes. The number of migrated cells was counted by means of phase-contrast microscopy (×320). Four randomly chosen fields were counted per insert.

CELL PROLIFERATION ASSAYS

Two methods of measuring cell proliferation were used. Subconfluent CECs grown in 6-well plates were treated with recombinant CTGF (0, 1, 10, 50, and 100 ng/mL) for 48 hours. Cell proliferation was measured by cell counting of representative triplicate samples with a hemocytometer, and by tritiated thymidine uptake assay as previously described.28

CEC TUBE FORMATION

The CECs were subcultured on fibronectin-coated, 6-well plates. The original medium was replaced with essential growth media containing 1% fetal bovine serum and 20-ng/mL CTGF, and cells were incubated for 9 days. Tube formation was monitored every day by phase-contrast microscopy.

CTGF EXPRESSION IN HUMAN CNVM

All 13 CNVMs stained positively for CTGF, with the most prominent staining found in the vascularized regions of the membranes (Figure 1A). Portions of the intact RPE monolayer were found in 5 membranes; occasional RPE in these regions stained strongly positive for CTGF(Figure 1D). Fibrotic regions of the membranes showed focal CTGF staining in the fibroblastic stromal cells(Figure 1C). Double staining of the CTGF-positive cells in 4 membranes disclosed that many of the CTGF-positive cells were also cytokeratin positive, indicating that these cells were transdifferentiated RPE cells (Figure 1B). A smaller number of CTGF-positive cells were endothelial cells, as confirmed by double labeling with CD-31 and CTGF (Figure 1E). A series of 3 normal adult retinas were also stained for CTGF, and no expression was found in the RPE or CECs (results not shown). Specificity of the CTGF antiserum was demonstrated by staining serial sections with CTGF antiserum(Figure 1C) and antiserum preadsorbed with recombinant CTGF (Figure 1F); staining with preadsorbed antiserum resulted in negligible backgound staining.

CTGF m RNA EXPRESSION IN RPE AND CECs

The expression of CTGF m RNA was demonstrated in cultured human RPE cells and bovine CECs by means of reverse transcriptase polymerase chain reaction with species-specific primer sets (Figure 2). As predicted by the complementary DNA sequences, the human CTGF polymerase chain reaction product was 210 base pairs (bp), while the bovine product was 220 bp. When complementary DNA was omitted from the reaction mixture, no product was obtained (negative control; result not shown).

Place holder to copy figure label and caption
Figure 2.

Connective tissue growth factor(CTGF) messenger RNA expressed in cultured human retinal pigment epithelial cells (A) and bovine choroidal endothelial cells (B). Species-specific primer sets were used for reverse transcriptase polymerase chain reaction. The size of the CTGF-specific band on the gel is 210 base pairs for human CTGF and 220 base pairs for bovine CTGF. The experiment was repeated 3 times with similar results.

Grahic Jump Location
REGULATIONS OF CTGF EXPRESSION

Cultures of both human RPE and bovine CECs expressed CTGF protein that was identified on Western blot as a doublet of 36 to 38 k Da (Figure 3). Stimulation of RPE cells with TGF-β2 for 48 hours at concentrations of between 1 and 30 ng/mL caused a marked increase of CTGF protein expression (Figure 3A), with the greatest effect at 1 and 20 ng/mL. In contrast, VEGF stimulation had no effect on RPE production of CTGF (Figure 3B). In CECs, VEGF stimulation for 48 hours at concentrations between 10 and 50 ng/mL resulted in increased expression of CTGF protein with a maximal effect at 50 ng/mL (Figure 3D). In contrast, culture of CECs with TGF-β did not stimulate expression of CTGF in CECs (Figure 3C).

Place holder to copy figure label and caption
Figure 3.

Regulation of connective tissue growth factor (CTGF) protein expression in retinal pigment epithelial (RPE) cells (A and B) and choroidal endothelial cells (CECs) (C and D). Western blotting was performed with RPE and CEC lysates and polyclonal CTGF antibody. The CTGF protein was identified as a 36- to 38-k Da doublet in unstimulated cells. Transforming growth factor β2 (TGF-β2)stimulated CTGF protein expression in RPE that was maximal between 1 and 20 ng/mL (A) but had no effect on CECs (B). Vascular endothelial growth factor(VEGF) stimulated CTGF protein expression in CECs with a maximal effect at 30 ng/mL (D) but had no significant effect on RPE (C). The experiment was repeated 3 times with similar results.

Grahic Jump Location
EFFECT OF CTGF ON CEC FUNCTION

The migration of CECs in the modified Boyden chamber assay was stimulated by recombinant CTFG (Figure 4). The stimulation was concentration dependent, with the maximal response to CTGF at a concentration of 30 ng/mL in the medium (P<.05). Interestingly, the maximal CTGF response was as effective as VEGF (10 ng/mL) in stimulating CEC migration. The dose of VEGF shown is submaximal and the CTGF effect is significantly less than a maximal VEGF stimulation. Stimulation of CEC with CTGF (10-100 ng/mL) for 48 hours also increased attachment of the cells to fibronectin (P<.05) (Figure 5). The effect was dose dependent, with a maximal effect at 50 to 100 ng/mL. Stimulation of CECs with CTGF (1-100 ng/mL) for 48 hours produced no proliferative response as measured by thymidine uptake or by cell counting (results not shown). When CECs were plated on fibronectin for 9 days in the presence of 1% serum, there was minimal, if any, tube formation (Figure 6A). In the presence of CTGF, 20 ng/mL, the attached endothelial cells extended cell processes, formed cell-cell contact, and established a branched network of tubelike structures (Figure 6B).

Place holder to copy figure label and caption
Figure 4

Stimulation of migration of bovine choroidal endothelial cells by connective tissue growth factor (CTGF) with the use of a modified Boyden chamber. A dose-dependent increase in migration was found with a maximal effect at 30 ng/mL (asterisks, P<.05). The maximal stimulation was similar to that found in response to vascular endothelial growth factor (VEGF) (10 ng/mL). Results are from 3 independent experiments.

Grahic Jump Location
Place holder to copy figure label and caption
Figure 5.

Stimulation of attachment of choroidal endothelial cells to fibronectin by connective tissue growth factor (CTGF). Attachment was increased in a dose-response manner by pretreatment with CTGF at concentrations of up to 100 ng/mL (asterisks, P<.05). Results are from 3 independent experiments. OD indicates optical density.

Grahic Jump Location
Place holder to copy figure label and caption
Figure 6.

Phase-contrast photomicrographs showing tube formation induced by connective tissue growth factor in choroidal endothelial cells grown on fibronectin. In control cultures (A), no discrete tubes were formed during the 9-day period of observation. In cultures stimulated with connective tissue growth factor (B), branching tubelike structures are widespread (arrows). The experiment was repeated 3 times with similar results(original magnification Ă—140).

Grahic Jump Location

Growth factors play an important role in the development, progression, and regression of pathological angiogenesis. In choroidal neovascularization, studies have demonstrated the presence of a complex mixture of angiogenic and antiangiogenic molecules, whose interactions likely result in the neovascular response.9 - 13 ,29 In this study, we demonstrate that our series of CNVMs uniformly express CTGF and that this expression is most prominent in the vascular regions of the membrane. The expression of CTGF is localized to stromal RPE and CECs as well as RPE in the residual monolayer. The pattern of immunoreactivity is similar to that seen previously for VEGF and provides support for the central role of RPE and their secreted growth factors in the pathogenesis of the disorder.9 No CTGF immunoreactivity was found in the RPE or CECs of normal adult retinas, consistent with previous reports that CTGF is undetectable in normal vessels, 30 - 31 but high expression levels are found in endothelial cells of atherosclerotic lesions and other angiogenic sites.32 The presence of CTGF in the residual RPE monolayer of CNVMs suggests the possibility that CTGF has the potential to activate normal underlying choroidal endothelium.

This article demonstrates for the first time, to our knowledge, that RPE and CECs each express CTGF m RNA and protein in vitro. There is considerable evidence that CTGF is a major downstream effector of TGF-β action in many cell types, 15 - 16 ,33 - 34 and TGF-β clearly up-regulates CTGF protein expression in RPE. The effect of TGF-β on endothelial cell subtypes, however, is more controversial. The expression of CTGF is up-regulated by TGF-β in periaortic, omental, and retinal endothelial cells, but not pulmonary or aortic endothelial cells.35 In this study, we saw no increase in CTGF protein when bovine CECs were stimulated with TGF-β. The mechanism of the differential response to TGF-β in various cell types has not been defined; however, induction of CTGF by TGF-β in fibroblasts is largely at the level of transcription initiation.36

The regulation of CTGF by VEGF in endothelial cells is also controversial. Although VEGF up-regulates CTGF in bovine retinal endothelial cells, there was no such up-regulation in retinal vascular endothelial cells from Macaca mulatta.20 ,22 Our results clearly show that VEGF stimulation of bovine CEC results in increased CTGF protein expression. The possibility that other factors play a role in stimulating CTGF expression should also be considered, since CTGF has also been shown to be regulated by advanced glycosylation end products, mechanical stress, or hypoxia.37 - 39

In this report, we show that CTGF stimulates CEC migration, adhesion to fibronectin, and tube formation. One of the characteristic features of CTGF is its induction of a fibrotic response, typified by the increased production of extracellular matrix molecules by fibroblasts.33 In support of this possibility, CTGF m RNA was recently demonstrated by in situ hybridization in transdifferentiated RPE cells in association with type 1 collagen in an epiretinal fibrovascular membrane.40

Our results demonstrate that CTGF is expressed by RPE and CECs, and that CTGF has the potential to stimulate choroidal angiogenesis through regulation of CEC function. These results, together with the observation that CTGF is prominently expressed in CNVM, suggest that CTGF may participate in the pathogenesis of CNVM in age-related macular degeneration.

Corresponding author: David R. Hinton, MD, FRCPC, Department of Pathology and Ophthalmology, 2011 Zonal Ave, HMR 209, Los Angeles, CA 90033 (e-mail: dhinton@usc.edu).

Bressler  NM, Bressler  SB, Fine  SL. Age-related macular degeneration. Surv Ophthalmol. 1988;32375- 413
PubMed
Ferris  FD, Fine  SL, Hyman  I. Age-related macular degeneration and blindness due to neovascular maculopathy. Arch Ophthalmol. 1984;1021640- 1642
PubMed
D'Amore  PA. Mechanisms of retinal and choroidal neovascularization. Invest Ophthalmol Vis Sci. 1994;353974- 3979
PubMed
Heriot  WJ, Henkind  P, Belhorn  RW, Burns  MS. Choroidal neovascularization can digest Bruch's membrane. Ophthalmology. 1984;911603- 1608
PubMed
Husain  D, Ambati  B, Adamis  AP, Miller  JW. Mechanisms of age-related macular degeneration. Ophthalmol Clin North Am. 2002;1587- 91
PubMed
Hinton  DR, He  S, Lopez  PF. Apoptosis in surgically excised choroidal neovascularization membranes in age-related macular degeneration. Arch Ophthalmol. 1998;116203- 209
PubMed
Grossniklaus  HE, Martinez  JA, Brown  VB.  et al.  Immunohistochemical and histochemical properties of surgically excised subretinal neovascular membranes in age-related macular degeneration. Am J Ophthalmol. 1992;114464- 472
PubMed
Das  A, Pulkin  JE, Frank  RN, Zhang  NL. Ultrastructural immunocytochemistry of subretinal neovascular membrane in age-related macular degeneration. Ophthalmology. 1992;991368- 1376
PubMed
Lopez  PF, Sippy  BD, Lambert  HM, Thach  AB, Hinton  DR. Transdifferentiated retinal pigment epithelial cells are immunoreactive for vascular endothelial growth factor in surgically excised age-related macular degeneration-related choroidal neovascular membrane. Invest Ophthalmol Vis Sci. 1996;37855- 868
PubMed
Amin  R, Pulkin  JE, Frank  RN. Growth factor localization in choroidal neovascular membranes of age-related macular degeneration. Invest Ophthalmol Vis Sci. 1994;353178- 3188
PubMed
Kliffen  M, Sharma  HS, Mooy  CM, Kerkvliet  S, de Jong  PTVM. Increased expression of angiogenic growth factors in age-related maculopathy. Br J Ophthalmol. 1997;81154- 162
PubMed
Otani  A, Takagi  H, Oh  H, Koyama  S, Matsumura  M, Honda  Y. Expression of angiopoietins and Tie-2 in human choroidal neovascular membrane. Invest Ophthalmol Vis Sci. 1999;401912- 1920
PubMed
Grossniklaus  HE, Ling  JX, Wallace  TM.  et al.  Macrophage and retinal pigment epithelium expression of angiogenic cytokines in choroidal neovascularization. Mol Vis. 2002;8119- 126
PubMed
Bradham  DM, Iagarashi  A, Potter  RL, Grotendorst  GR. Connective tissue growth factor. J Cell Biol. 1991;1141285- 1294
PubMed
Moussad  EEA, Brigstock  DR. Connective tissue growth factor: what's in a name? Mol Genet Metab. 2000;71276- 292
PubMed
Perbal  B. NOV (nephroblastoma overexpressed) and the CCN family of genes: structural and functional issues. Mol Pathol. 2001;5457- 79
PubMed
Shimo  T, Nakanishi  T, Nishida  T.  et al.  Connective tissue growth factor induces the proliferation, migration, and tube formation of vascular endothelial cells in vitro, and angiogenesis in vivo. J Biochem (Tokyo). 1999;126137- 145
PubMed
Babic  AM, Chen  CC, Lau  LF. Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin αvβ3, promotes endothelial cell survival, and induces angiogenesis. Mol Cell Biol. 1999;192958- 2966
PubMed
Shimo  T, Nakanishi  T, Kimura  Y.  et al.  Inhibition of endogenous expression of connective tissue growth factor by its antisense oligonucleotide and antisense RNA suppresses proliferation and migration of vascular endothelial cells. J Biochem (Tokyo). 1998;124130- 140
PubMed
Suzuma  K, Naruse  K, Suzuma  I.  et al.  Vascular endothelial growth factor induces expression of connective tissue growth factor via KDR, Flt1, and phosphatidylinositol 3-kinase-akt-dependent pathways in retinal vascular cells. J Biol Chem. 2000;27540725- 40731
PubMed
Wunderlich  K, Senn  BC, Todesco  L, Flammer  J, Meyer  P. Regulation of connective tissue growth factor gene expression in retinal vascular endothelial cells by angiogenic growth factors. Graefes Arch Clin Exp Ophthalmol. 2000;238910- 915
PubMed
Ghitescu  L, Robert  M. Diversity in unity: the biochemical composition of the endothelial cell surface varies between the vascular beds. Microsc Res Tech. 2002;57381- 389
PubMed
Trepel  M, Arap  W, Pasqualini  R. In vivo phage display and vascular heterogeneity: implications for targeted medicine. Curr Opin Chem Biol. 2002;6399- 404
PubMed
Bill  A, Sperber  G, Ujiie  K. Physiology of the choroid vascular bed. Int Ophthalmol. 1983;6101- 107
PubMed
Craig  LE, Spelman  JP, Strandberg  JD, Zink  MC. Endothelial cells from diverse tissues exhibit differences in growth and morphology. Microvasc Res. 1998;5565- 76
Jin  M, He  S, Worpel  V, Ryan  SJ, Hinton  DR. Promotion of adhesion and migration of RPE cells to provisional extracellular matrices by TNF-α. Invest Ophthalmol Vis Sci. 2000;414324- 4332
PubMed
Hoffmann  S, Spee  C, Murata  T, Cui  JZ, Ryan  SJ, Hinton  DR. Rapid isolation of chorioocapillary endothelial cells by Lycopersicon esculentum– coated Dynabeads. Graefes Arch Clin Exp Ophthalmol. 1998;236779- 784
PubMed
He  PM, He  S, Garner  JA, Ryan  SJ, Hinton  DR. Retinal pigment epithelial cells secrete and respond to hepatocyte growth factor. Biochem Biophys Res Commun. 1998;249253- 257
PubMed
Holekamp  NM, Bouck  N, Volpert  O. Pigment epithelium–derived factor is deficient in the vitreous of patients with choroidal neovascularization due to age-related macular degeneration. Am J Ophthalmol. 2002;134220- 227
PubMed
Igarashi  A, Nashiro  K, Kikuchi  K.  et al.  Significant correlation between connective tissue growth factor gene expression and skin sclerosis in tissue sections from patients with systemic sclerosis. J Invest Dermatol. 1995;105280- 284
PubMed
Igarashi  A, Nashiro  K, Kikuchi  K.  et al.  Connective tissue growth factor gene expression in tissue sections from localized scleroderma, keloid, and other fibrotic skin disorders. J Invest Dermatol. 1996;106729- 733
PubMed
Oeman  BS, Werner  A, Garnier  JM.  et al.  Human connective tissue growth factor is expressed in advanced atherosclerotic lesions. Circulation. 1997;95831- 839
PubMed
Frazier  K, Williams  S, Kothapalli  D, Klapper  H, Grotendorst  GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol. 1996;107404- 411
PubMed
Mori  T, Kawara  S, Shinozaki  M.  et al.  Role and interaction of connective tissue growth factor with transforming growth factor-β in persistent fibrosis: a mouse fibrosis model. J Cell Physiol. 1999;181153- 159
PubMed
Boes  M, Dake  BL, Booth  BA.  et al.  Connective tissue growth factor (IGFBP-r P2) expression and regulation in cultured bovine endothelial cells. Endocrinology. 1999;1401575- 1580
PubMed
Grotendorst  GR, Okochi  H, Hayashi  N. A novel transforming growth factor beta response element controls the expression of connective tissue growth factor. Cell Growth Differ. 1996;7469- 480
PubMed
Twigg  SM, Chen  MM, Joly  AH.  et al.  Advanced glycosylation end products up-regulate connective tissue growth factor (insulin-like growth factor-binding protein-related protein 2) in human fibroblasts. Endocrinology. 2001;1421760- 1769
PubMed
Schild  C, Trueb  B. Mechanical stress is required for high-level expression of connective tissue growth factor. Exp Cell Res. 2002;27483- 91
PubMed
Kondo  S, Kubota  S, Shimo  T.  et al.  Connective tissue growth factor increased by hypoxia may initiate angiogenesis in collaboration with matrix metalloproteinases. Carcinogenesis. 2002;23769- 776
PubMed
Meyer  P, Wunderlicj  K, Kain  HL, Prunte  C, Flammer  J. Human connective tissue growth factor m RNA expression of epiretinal and subretinal fibrovascular membranes: a report of three cases. Ophthalmologica. 2002;216284- 291
PubMed

Submitted for publication October 22, 2002; final revision received April 10, 2003; accepted May 14, 2003.

This study was supported in part by a grant from Prevent Blindness America, New York, NY; the Arnold and Mabel Beckman Foundation, Irvine, Calif; grant EY03040 from the National Institutes of Health, Bethesda, Md; and an unrestricted grant to the Doheny Eye Institute from Research to Prevent Blindness Inc, New York.

Fibro Gen, Inc provided CTGF reagents used in this study.

We thank Noelynn Oliver, PhD, for her critical review of the manuscript, Christine Spee for isolation and culture of the ocular cells, and Ernesto Barron for preparation of the figures. We appreciate the editorial assistance of Susan Clarke and Thomas E. Ogden, MD, PhD.

First Page Preview

First page PDF preview

Figures

Place holder to copy figure label and caption
Figure 1

A, C and D, Immunoperoxidase staining of surgically excised choroidal neovascular membranes for connective tissue growth factor (CTGF) with the use of aminoethyl carbazole as the chromogen(red) and a hematoxylin (blue) nuclear counterstain. The melanin pigment appears brown. In A, a vascular membrane shows typical stromal cells positive for CTGF (arrows). In C and D, a fibrotic membrane is seen with attached residual retinal pigment epithelial monolayer overlying a thickened Bruch membrane. Note that occasional residual retinal pigment epithelial cells are strongly positive for CTGF (D, arrow at top). Stromal cells are also CTGF positive(C, D, arrows in lower half). B, E, Double immunoperoxidase stains for CTGF(red) and cell-specific markers (blue) with no counterstain. In B, several cells double label for CTGF (red) and cytokeratin (blue), indicating colocalization in cells derived from retinal pigment epithelium (arrows). In E, cells lining vascular spaces double label with CTGF (red) and CD31 (blue), indicating colocalization in endothelial cells (arrow). F, A section adjacent to that shown in C is stained in the same manner as in C, except that the primary CTGF antiserum was preadsorbed with recombinant CTGF. Note that F shows only negligible background staining. Digital images were obtained with a digital camera (SPOT; Diagnostic Instruments Incorporated, Sterling Heights, Mich) mounted on a photomicroscope(Olympus America Inc, Melville, NY) (for all, original magnification Ă—500).

Grahic Jump Location
Place holder to copy figure label and caption
Figure 2.

Connective tissue growth factor(CTGF) messenger RNA expressed in cultured human retinal pigment epithelial cells (A) and bovine choroidal endothelial cells (B). Species-specific primer sets were used for reverse transcriptase polymerase chain reaction. The size of the CTGF-specific band on the gel is 210 base pairs for human CTGF and 220 base pairs for bovine CTGF. The experiment was repeated 3 times with similar results.

Grahic Jump Location
Place holder to copy figure label and caption
Figure 3.

Regulation of connective tissue growth factor (CTGF) protein expression in retinal pigment epithelial (RPE) cells (A and B) and choroidal endothelial cells (CECs) (C and D). Western blotting was performed with RPE and CEC lysates and polyclonal CTGF antibody. The CTGF protein was identified as a 36- to 38-k Da doublet in unstimulated cells. Transforming growth factor β2 (TGF-β2)stimulated CTGF protein expression in RPE that was maximal between 1 and 20 ng/mL (A) but had no effect on CECs (B). Vascular endothelial growth factor(VEGF) stimulated CTGF protein expression in CECs with a maximal effect at 30 ng/mL (D) but had no significant effect on RPE (C). The experiment was repeated 3 times with similar results.

Grahic Jump Location
Place holder to copy figure label and caption
Figure 4

Stimulation of migration of bovine choroidal endothelial cells by connective tissue growth factor (CTGF) with the use of a modified Boyden chamber. A dose-dependent increase in migration was found with a maximal effect at 30 ng/mL (asterisks, P<.05). The maximal stimulation was similar to that found in response to vascular endothelial growth factor (VEGF) (10 ng/mL). Results are from 3 independent experiments.

Grahic Jump Location
Place holder to copy figure label and caption
Figure 5.

Stimulation of attachment of choroidal endothelial cells to fibronectin by connective tissue growth factor (CTGF). Attachment was increased in a dose-response manner by pretreatment with CTGF at concentrations of up to 100 ng/mL (asterisks, P<.05). Results are from 3 independent experiments. OD indicates optical density.

Grahic Jump Location
Place holder to copy figure label and caption
Figure 6.

Phase-contrast photomicrographs showing tube formation induced by connective tissue growth factor in choroidal endothelial cells grown on fibronectin. In control cultures (A), no discrete tubes were formed during the 9-day period of observation. In cultures stimulated with connective tissue growth factor (B), branching tubelike structures are widespread (arrows). The experiment was repeated 3 times with similar results(original magnification Ă—140).

Grahic Jump Location

Tables

Interactive Graphics

Video

Country-Specific Mortality and Growth Failure in Infancy and Yound Children and Association With Material Stature

Use interactive graphics and maps to view and sort country-specific infant and early dhildhood mortality and growth failure data and their association with maternal

Bressler  NM, Bressler  SB, Fine  SL. Age-related macular degeneration. Surv Ophthalmol. 1988;32375- 413
PubMed
Ferris  FD, Fine  SL, Hyman  I. Age-related macular degeneration and blindness due to neovascular maculopathy. Arch Ophthalmol. 1984;1021640- 1642
PubMed
D'Amore  PA. Mechanisms of retinal and choroidal neovascularization. Invest Ophthalmol Vis Sci. 1994;353974- 3979
PubMed
Heriot  WJ, Henkind  P, Belhorn  RW, Burns  MS. Choroidal neovascularization can digest Bruch's membrane. Ophthalmology. 1984;911603- 1608
PubMed
Husain  D, Ambati  B, Adamis  AP, Miller  JW. Mechanisms of age-related macular degeneration. Ophthalmol Clin North Am. 2002;1587- 91
PubMed
Hinton  DR, He  S, Lopez  PF. Apoptosis in surgically excised choroidal neovascularization membranes in age-related macular degeneration. Arch Ophthalmol. 1998;116203- 209
PubMed
Grossniklaus  HE, Martinez  JA, Brown  VB.  et al.  Immunohistochemical and histochemical properties of surgically excised subretinal neovascular membranes in age-related macular degeneration. Am J Ophthalmol. 1992;114464- 472
PubMed
Das  A, Pulkin  JE, Frank  RN, Zhang  NL. Ultrastructural immunocytochemistry of subretinal neovascular membrane in age-related macular degeneration. Ophthalmology. 1992;991368- 1376
PubMed
Lopez  PF, Sippy  BD, Lambert  HM, Thach  AB, Hinton  DR. Transdifferentiated retinal pigment epithelial cells are immunoreactive for vascular endothelial growth factor in surgically excised age-related macular degeneration-related choroidal neovascular membrane. Invest Ophthalmol Vis Sci. 1996;37855- 868
PubMed
Amin  R, Pulkin  JE, Frank  RN. Growth factor localization in choroidal neovascular membranes of age-related macular degeneration. Invest Ophthalmol Vis Sci. 1994;353178- 3188
PubMed
Kliffen  M, Sharma  HS, Mooy  CM, Kerkvliet  S, de Jong  PTVM. Increased expression of angiogenic growth factors in age-related maculopathy. Br J Ophthalmol. 1997;81154- 162
PubMed
Otani  A, Takagi  H, Oh  H, Koyama  S, Matsumura  M, Honda  Y. Expression of angiopoietins and Tie-2 in human choroidal neovascular membrane. Invest Ophthalmol Vis Sci. 1999;401912- 1920
PubMed
Grossniklaus  HE, Ling  JX, Wallace  TM.  et al.  Macrophage and retinal pigment epithelium expression of angiogenic cytokines in choroidal neovascularization. Mol Vis. 2002;8119- 126
PubMed
Bradham  DM, Iagarashi  A, Potter  RL, Grotendorst  GR. Connective tissue growth factor. J Cell Biol. 1991;1141285- 1294
PubMed
Moussad  EEA, Brigstock  DR. Connective tissue growth factor: what's in a name? Mol Genet Metab. 2000;71276- 292
PubMed
Perbal  B. NOV (nephroblastoma overexpressed) and the CCN family of genes: structural and functional issues. Mol Pathol. 2001;5457- 79
PubMed
Shimo  T, Nakanishi  T, Nishida  T.  et al.  Connective tissue growth factor induces the proliferation, migration, and tube formation of vascular endothelial cells in vitro, and angiogenesis in vivo. J Biochem (Tokyo). 1999;126137- 145
PubMed
Babic  AM, Chen  CC, Lau  LF. Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin αvβ3, promotes endothelial cell survival, and induces angiogenesis. Mol Cell Biol. 1999;192958- 2966
PubMed
Shimo  T, Nakanishi  T, Kimura  Y.  et al.  Inhibition of endogenous expression of connective tissue growth factor by its antisense oligonucleotide and antisense RNA suppresses proliferation and migration of vascular endothelial cells. J Biochem (Tokyo). 1998;124130- 140
PubMed
Suzuma  K, Naruse  K, Suzuma  I.  et al.  Vascular endothelial growth factor induces expression of connective tissue growth factor via KDR, Flt1, and phosphatidylinositol 3-kinase-akt-dependent pathways in retinal vascular cells. J Biol Chem. 2000;27540725- 40731
PubMed
Wunderlich  K, Senn  BC, Todesco  L, Flammer  J, Meyer  P. Regulation of connective tissue growth factor gene expression in retinal vascular endothelial cells by angiogenic growth factors. Graefes Arch Clin Exp Ophthalmol. 2000;238910- 915
PubMed
Ghitescu  L, Robert  M. Diversity in unity: the biochemical composition of the endothelial cell surface varies between the vascular beds. Microsc Res Tech. 2002;57381- 389
PubMed
Trepel  M, Arap  W, Pasqualini  R. In vivo phage display and vascular heterogeneity: implications for targeted medicine. Curr Opin Chem Biol. 2002;6399- 404
PubMed
Bill  A, Sperber  G, Ujiie  K. Physiology of the choroid vascular bed. Int Ophthalmol. 1983;6101- 107
PubMed
Craig  LE, Spelman  JP, Strandberg  JD, Zink  MC. Endothelial cells from diverse tissues exhibit differences in growth and morphology. Microvasc Res. 1998;5565- 76
Jin  M, He  S, Worpel  V, Ryan  SJ, Hinton  DR. Promotion of adhesion and migration of RPE cells to provisional extracellular matrices by TNF-α. Invest Ophthalmol Vis Sci. 2000;414324- 4332
PubMed
Hoffmann  S, Spee  C, Murata  T, Cui  JZ, Ryan  SJ, Hinton  DR. Rapid isolation of chorioocapillary endothelial cells by Lycopersicon esculentum– coated Dynabeads. Graefes Arch Clin Exp Ophthalmol. 1998;236779- 784
PubMed
He  PM, He  S, Garner  JA, Ryan  SJ, Hinton  DR. Retinal pigment epithelial cells secrete and respond to hepatocyte growth factor. Biochem Biophys Res Commun. 1998;249253- 257
PubMed
Holekamp  NM, Bouck  N, Volpert  O. Pigment epithelium–derived factor is deficient in the vitreous of patients with choroidal neovascularization due to age-related macular degeneration. Am J Ophthalmol. 2002;134220- 227
PubMed
Igarashi  A, Nashiro  K, Kikuchi  K.  et al.  Significant correlation between connective tissue growth factor gene expression and skin sclerosis in tissue sections from patients with systemic sclerosis. J Invest Dermatol. 1995;105280- 284
PubMed
Igarashi  A, Nashiro  K, Kikuchi  K.  et al.  Connective tissue growth factor gene expression in tissue sections from localized scleroderma, keloid, and other fibrotic skin disorders. J Invest Dermatol. 1996;106729- 733
PubMed
Oeman  BS, Werner  A, Garnier  JM.  et al.  Human connective tissue growth factor is expressed in advanced atherosclerotic lesions. Circulation. 1997;95831- 839
PubMed
Frazier  K, Williams  S, Kothapalli  D, Klapper  H, Grotendorst  GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol. 1996;107404- 411
PubMed
Mori  T, Kawara  S, Shinozaki  M.  et al.  Role and interaction of connective tissue growth factor with transforming growth factor-β in persistent fibrosis: a mouse fibrosis model. J Cell Physiol. 1999;181153- 159
PubMed
Boes  M, Dake  BL, Booth  BA.  et al.  Connective tissue growth factor (IGFBP-r P2) expression and regulation in cultured bovine endothelial cells. Endocrinology. 1999;1401575- 1580
PubMed
Grotendorst  GR, Okochi  H, Hayashi  N. A novel transforming growth factor beta response element controls the expression of connective tissue growth factor. Cell Growth Differ. 1996;7469- 480
PubMed
Twigg  SM, Chen  MM, Joly  AH.  et al.  Advanced glycosylation end products up-regulate connective tissue growth factor (insulin-like growth factor-binding protein-related protein 2) in human fibroblasts. Endocrinology. 2001;1421760- 1769
PubMed
Schild  C, Trueb  B. Mechanical stress is required for high-level expression of connective tissue growth factor. Exp Cell Res. 2002;27483- 91
PubMed
Kondo  S, Kubota  S, Shimo  T.  et al.  Connective tissue growth factor increased by hypoxia may initiate angiogenesis in collaboration with matrix metalloproteinases. Carcinogenesis. 2002;23769- 776
PubMed
Meyer  P, Wunderlicj  K, Kain  HL, Prunte  C, Flammer  J. Human connective tissue growth factor m RNA expression of epiretinal and subretinal fibrovascular membranes: a report of three cases. Ophthalmologica. 2002;216284- 291
PubMed

Correspondence

CME Course for:


You need to register in order to view this quiz.


To understand the clinical management of acute heart failure syndromes.
Accreditation Information The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians.
The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity.
Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
To view and print your certificate and access a summary of your CME courses go to My CME.
NOTE:
Citing articles are presented as examples only. In non-demo SCM6 implementation, integration with CrossRef’s “Cited By” API will populate this tab (http://www.crossref.org/citedby.html).
Submit a Response

Some tools below are only available to our subscribers or users with an online account.

Web of Science® Times Cited: 39

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Topics
PubMed Articles