0
Laboratory Sciences |

Mitochondrial Damage in the Trabecular Meshwork of Patients With GlaucomamtDNA Damage in Trabecular Meshwork in Glaucoma FREE

Alberto Izzotti, MD, PhD; Sergio C. Saccà, MD; Mariagrazia Longobardi, PhD; Cristina Cartiglia, PhD
[+] Author Affiliations

Author Affiliations: Department of Health Sciences, University of Genoa (Drs Izzotti, Longobardi, and Cartiglia), and Ophthalmology Unit, St. Martino Hospital (Dr Saccà), Genoa, Italy.


Copyright 2010 American Medical Association. All Rights Reserved. Applicable FARS/DFARS Restrictions Apply to Government Use.

More Author Information
Arch Ophthalmol. 2010;128(6):724-730. doi:10.1001/archophthalmol.2010.87
Text Size: A A A
Published online

Objectives  To analyze the frequency of mitochondrial DNA (mtDNA) damage in patients with primary open-angle glaucoma. Oxidative damage plays a major role in glaucoma pathogenesis. Since no environmental risk factor for glaucoma is recognized, we focused our attention on mitochondria, the main endogenous source of reactive oxygen species.

Methods  Mitochondrial damage was evaluated analyzing a common mtDNA deletion by real-time polymerase chain reaction in trabecular meshwork collected at surgery from 79 patients with primary open-angle glaucoma and 156 unaffected matched controls. In the same samples, polymorphisms of genes encoding for antioxidant defenses (GSTM1), repair of oxidative DNA damage (OGG1), and apoptosis (FAS) were tested.

Results  Mitochondrial DNA deletion was dramatically increased (5.32-fold; P = .01) in trabecular meshwork of patients with glaucoma vs controls. This finding was paralleled by a decrease in the number of mitochondria per cell (4.83-fold; P < .001) and by cell loss (16.36-fold; P < .01). Patients with glaucoma bearing the GSTM1-null genotype showed increased amounts of mtDNA deletion and a decreased number of mitochondria per cell as compared with GSTM1-positive subjects. Patients bearing a FAS homozygous mutation showed only a decreased number of mitochondria per cell.

Conclusions  Obtained results indicate that mitochondrion is targeted by the glaucomatous pathogenic processes. Some subjects bearing adverse genetic assets are more susceptible to this event.

Clinical Relevance  Oxidative damage to the trabecular meshwork exerts a pathogenic role in glaucoma inducing mitochondrial damage and triggering apoptosis and cell loss. This issue may be useful to develop new glaucoma molecular biomarkers and to identify high-risk subjects.

Figures in this Article

The trabecular meshwork (TM) is a key region for the initiation of glaucoma, the main cause of irreversible blindness worldwide. This tissue provides the conventional aqueous humor outflow from the anterior chamber. The functional impairment of TM leads to dysfunction of the outflow pathway1 and triggers glaucoma pathogenesis. The progressive loss of TM cells observed in patients with glaucoma has been attributed to the long-term effect of oxidative free radicals.2 3 Reactive oxygen species are able to alter TM function.4 5 Accordingly, the intraocular pressure (IOP) increase, characterizing most glaucomas, is related to oxidatively induced degenerative processes affecting TM. Oxidative stress plays a role in glaucoma development initially by damaging TM cells, then altering nitric oxide and endothelin homeostasis, and finally contributing to ganglional cell death.6

Although much experimental evidence indicates that oxidative damage is implicated in the pathogenesis of primary open-angle glaucoma (POAG), the source of such damage remains to be identified. No environmental sources of oxidative stress, such as cigarette smoke or radiation, have been involved in glaucoma pathogenesis.7 Mitochondria are the most important endogenous source of reactive oxygen species in cells.8 Mitochondria possess their own genetic material, the mitochondrial DNA (mtDNA), a circular double-strand DNA lacking nucleosomal structure and DNA repair systems. These features make mtDNA particularly susceptible to damage induced by reactive oxygen species, which causes mitochondrial failure and increased endogenous production of oxidative damaging species, thus establishing a “vicious cycle.”9

Mitochondrial damage is involved in the pathogenesis of many chronic degenerative diseases. Some experimental findings suggest a possible role of mitochondrial damage in POAG, which, however, still remains to be demonstrated.10 11 A common marker of mtDNA damage associated with oxidative stress is the 4977–base pair (bp) common deletion (mtDNA4977),9 involving the loss of more than one-fourth of the whole mitochondrial genome, disrupting 3 complexes of genes coding for proteins involved in oxidative phosphorylation.12

The aim of our study was to analyze the frequency of mtDNA4977 in patients with POAG vs controls to evaluate the role of mitochondrial dysfunction in the glaucomatous TM. This end point was analyzed in the iris of the same patients to evaluate the peculiar susceptibility of TM to oxidative stress as compared with other anterior chamber tissues. This issue is relevant because we recently demonstrated that TM is the most sensitive tissue to in vitro oxidative stress in the anterior chamber.13

The quantification of mtDNA4977 was carried out by quantitative polymerase chain reaction (QPCR), which is highly sensitive and reliable as confirmed by the increasing number of articles using this method.14 15

Insofar, evidence demonstrating the purported role of mitochondrial damage in POAG pathogenesis is overwhelming, but most results were not obtained using POAG target tissue, ie, the TM. Our study provides for the first time, to our knowledge, evidence that mitochondrial damage really occurs in the TM of patients with glaucoma, thus providing evidence for its pathogenic role in glaucoma.

Genetic factors predispose to POAG development. However, glaucomas caused by single gene mutations are extremely rare. The most relevant POAG-related mutations are those occurring in MYOC and OPTN, which occur in less than 3% of POAG.16 MYOC was demonstrated to be a structural component of the mitochondrial wall, further suggesting an important role of mitochondrial damage in POAG-related TM degeneration.17

Accordingly, the analysis of genetic risk factors should be also focused on genetic polymorphisms conferring a moderate risk but widely spread in the population. On this basis, we decided to analyze the role of frequent genetic polymorphisms as possible contributors to the mtDNA damage occurring in glaucomatous TM. Selected genes included (1) glutathione S-transferase 1 (GSTM1), coding a protein involved in the scavenging of reactive oxygen radicals18 ; (2) 8-oxo-guanine glycosylase 1 (OGG1), coding a protein repairing 8-oxo-2′-deoxyguanosine, the main oxidative DNA lesions increased in the TM of patients with POAG19 ; and (3) FAS, coding a protein involved in the activation of the apoptotic cascade.20

GSTM1 represents a pivotal intracellular defense against oxidative stress and its homozygous deletion has been associated with an increased level of oxidative DNA damage in TM.19 Accordingly, a GSTM1 polymorphism has been proposed as a possible risk factor for glaucoma, although other studies did not confirm this finding.21 22 OGG1 adverse polymorphisms inducing failure in its repairing ability have been related to increased sensitivity to oxidative damage, resulting in cell death.23 FAS polymorphisms modulate cell attitude to undergo apoptosis as a consequence of oxidative stress.20 The goal of our study was to analyze the interaction between mtDNA damage, genetic polymorphisms, and POAG.

SUBJECT RECRUITMENT AND SAMPLE COLLECTION

The study had a case-control design. Recruited cases had POAG requiring surgical intervention. Inclusion criterion for cases was the presence of POAG with no tonometric compensation established by clinical and instrumental examinations, as elsewhere reported.19 Main elements for POAG diagnosis were papilla morphology, IOP values, and visual field analysis.

Exclusion criterion was the presence of any other ocular, systemic, or neurological diseases other than POAG-related optic nerve damage. An additional exclusion criterion was the presence of any glaucoma types other than POAG. The TM samples were collected by standard surgical trabeculectomy, as previously reported.2 ,19 All the enrolled patients furnished an informed written consent and were treated in accordance with the Declaration of Helsinki.

Trabeculectomy specimens were collected from 79 patients with glaucoma, including 49 women and 30 men, mean (SE) age, 66.4 (2.19) years. All patients had an elevated IOP (minimum, 23 mm Hg; maximum, 36 mm Hg; mean [SE], 27.8 [3.69] mm Hg). Specificity of TM alterations was examined by analyzing the iris in a subgroup of 19 patients.

For control samples, we used trabeculectomy specimens collected from 156 subjects, mean (SE) age, 65.1 (1.17) years and sex matched with cases. Samples were collected from glaucoma-free cornea donors by the Melvin Jones Eye Bank, as previously reported.19

Sample collection from controls was performed no later than 1 hour after death, thus ensuring cell viability, as necessary for the corneal transplant. Samples were immersed in stabilizing buffers containing antioxidants and stored in a deep freezer (−80°C). DNA purification was performed by incubating samples with proteinase K followed by solvent extraction in an oxygen-free atmosphere.19

DETECTION OF mtDNA4977 DELETION AND mtDNA COPY NUMBER

Quantification of mtDNA4977 deletion and total mtDNA were performed by real-time PCR (QPCR) using fluorescent probes (Figure 1). Two QPCR reactions were performed in parallel for each sample, the first to detect the amount of total mtDNA, the second to quantify mtDNA4977 deletion. The total mtDNA reaction was carried out using 2 primers (total mtDNA sense: CCATCTTTGCAGGCACACTCATC and total mtDNA antisense: ATCCACCTCAACTGCCTGCTATG) flanking a sequence of mtDNA (474 bp) known not to be susceptible to the deletion24 and an ad hoc–designed FAM-labeled molecular beacon (total mtDNA: 5′-FAM-CGCGATCTCACGCAAGCAACCGCATCCATGATCGCG-BHQ1-3′). The mtDNA4977 deletion reaction was performed using 2 primers (deleted mtDNA sense: GGCCCGTATTTACCCTATAG and deleted mtDNA antisense: GGTGAGAAGAATTATTCGAGTG) recognizing mtDNA regions flanking the deletion site plus a molecular FAM-labeled beacon (deleted mtDNA: 5′-FAM-CGCGATCCAGCCTAGCATTAGCAGGAATACCTTGATCGCG-BHQ1-3′) targeting a DNA sequence between the 2 primers and ahead of the deletion site. Because of the short elongation time, only deleted mtDNA can efficiently produce amplicons (ie, double-strand DNA 400 bp) containing the target sequence for the deleted mtDNA molecular beacon.

Figure 1.

Evaluation of the 4977–base pair mitochondrial DNA (mtDNA4977) deletion and mtDNA copy number by real-time quantitative polymerase chain reaction in the trabecular meshwork. Molecular beacon probes emit fluorescent light only when the deletion of mtDNA is present.

Grahic Jump Location

A Basic Local Alignment Search Tool search for the deleted mtDNA amplicon and probe were performed with high specificity. The stringent conditions of the reaction are a further warrant for specificity. The incidental cross-reaction of the probe with genomic DNA was further assumed as negligible because mtDNA presents in each cell in multiple copy as compared with nuclear DNA (nDNA).

The reaction conditions were 5 μL of 10× PCR buffer, 0.4 μL of 100mM dNTP mix, 2 μL of 50mM magnesium chloride, 0.5 μL of platinum Taq polymerase (Invitrogen Corp, Carlsbad, California), 37.1 μL of sterile water, 1 μL of 10μM sense primer, 1 μL of 10μM antisense primer, 2 μL of molecular beacon, and 1 μL of DNA (25 ng).

The QPCR reactions were performed in a rotating real-time thermocycler (Rotorgene3000; Corbett Life Science, Sydney, Australia), using the following temperature ramp: 94°C for 2 minutes followed by 45 cycles at 94° for 30 seconds, annealing temperature of 54°C for total mtDNA and 51°C for deleted mtDNA for 30 seconds, and 72°C for 30 seconds. Fluorescence was acquired at the end of each annealing step. Each sample was tested in duplicate.

The reaction efficacies for the total mtDNA and mtDNA4977 deletion quantifications were assayed and the results were 0.73 and 0.78, respectively. An internal control was tested in each reaction and the results were expressed as relative quantity (sample/internal control). The specificity of the amplification product and the results were confirmed by capillary electrophoresis using the Agilent 2100 Bioanalyzer with a DNA 1000 Series II kit (Agilent Technologies, Waldbronn, Germany), thereby confirming QPCR results by capillary electrophoresis of amplified mtDNA sequences.

The relative ratio of deleted mtDNA to total mtDNA was assessed for each sample and normalized for cell number assayed quantifying by QPCR the housekeeping gene GAPDH. The amount of mtDNA4977 deletion was expressed as percentage of total mtDNA.

EVALUATION OF THE nDNA:mtDNA RATIO

The relative amount of total nDNA in each sample was evaluated by quantifying the copies of GAPDH by QPCR. This parameter was related both to mtDNA copy number (nDNA:mtDNA ratio) and to the amount of wet tissue processed (DNA per milligram of wet tissue). This last parameter was assumed as an indicator of cell number in TM.

GENETIC POLYMORPHISM ANALYSES

Genetic polymorphisms were analyzed in an aliquot (0.1 μg) of nDNA as purified from TM samples. The OGG1 Ser326Cys polymorphism, resulting from a C>G transversion in exon 7, was evaluated as previously described by QPCR using a pair of gene-specific molecular beacons to discriminate between the occurrence of this genetic variant on both alleles (homozygous mutant), 1 allele only (heterozygous), or no allele (wild type).25 The FAS promoter 670 polymorphism, resulting from an A/G substitution at the 670 nucleotide position in the enhancer region of the gene, was evaluated by QPCR using a set of gene-specific molecular beacons to distinguish the occurrence of this genetic variant on both alleles (homozygous mutant), 1 allele only (heterozygous), or no allele (wild type).

Molecular beacon sequences were human FAS wild type: 5′-FAS-CGCGATCTGTCCATTCCAGAAACGTCTGTGAGCGATCGCG-BHQ1-3′ and human FAS mtDNA: 5′-HEX-CGCGATCTGTCCATTCCAGGAACGTCTGTGAGCGATCGCG-BHQ-3′. The PCR primer sequences were human FAS sense: 5′-CCCTTTTCAGAGCCCTATGG-3′ and human FAS antisense: 5′-TGCTGGAGTCACTCAGAGAAAG-3′. The reaction was performed at 94°C for 2 minutes, followed by 45 cycles at 94°C for 30 seconds, 66°C for 15 seconds, 64°C for 15 seconds, 53°C for 30 seconds, and 72°C for 30 seconds. The HEX signal was acquired at the end of the 66°C step and FAM signal, at the end of the 64°C step.

The GSTM1 polymorphism, including the gene presence on 1 or both alleles (positive) or its homozygous deletion (null), was investigated by QPCR as previously described.25 All primer sequences and PCR conditions were determined using Beacon Designer software (Premier Biosoft International, Palo Alto, California) purchased from TIB Molbiol (Berlin, Germany).

STATISTICAL ANALYSES

Comparisons among quantitative variables in different groups of patients were executed by analysis of variance and t test for unpaired data after checking the normality of the distribution by skew kurtosis analysis. The accepted level of significance in all cases was P < .05. In situations without a normal distribution of data, a nonparametric test was used (Mann-Whitney U test and Kruskal-Wallis test). Correlations between continuous variables were tested by linear regression analysis. Differences of frequency distributions among nominal variables were tested by χ2 test. All statistical analyses were performed using Statview software (Abacus Concept, Berkeley, California).

mtDNA COPY NUMBER AND mtDNA4977 DELETION IN TM OF PATIENTS WITH POAG VS CONTROLS

A remarkably high level of molecular damage was detected in mtDNA in the TM of patients with POAG as compared with unaffected controls. In particular, there was a statistically significant 5.32-fold increase in the level of mtDNA4977 deletion in the TM of patients with glaucoma as compared with controls (Table 1). These data were confirmed by capillary electrophoresis, resulting a 1.7-fold increase in the level of mtDNA4977 deletion in the TM of patients with glaucoma as compared with controls (Figure 2). Furthermore, the results were validated performing the same analysis on mtDNA as purified from isolated mitochondria (Mitochondrial Isolation Kit; Pierce, Rockford, Illinois) collected from the same tissue.

Figure 2.

Electropherogram of the amplification products. A, The peak at elution time 95 seconds corresponds to the 474–base pair (bp) tract of mitochondrial DNA (mtDNA) not susceptible to deletion. B, The peak at elution time 90 seconds corresponds to the 400-bp amplicon flanking the deletion site. The blue line corresponds to a control sample and the red line, to a primary open-angle glaucoma (POAG) sample. Part A shows that the amount of mtDNA in both samples was the same (the curves overlap perfectly). Part B shows that the deletion amount is higher in the POAG sample than in the control sample (red peak higher than the blue one).

Grahic Jump Location
Table Grahic Jump LocationTable 1. mtDNA Damage in TM as Detected in 79 Patients With POAG and 156 Controls

The variability of the results obtained in cases was remarkable and cannot be attributed to interexperimental variability, which fell lower than 30% when replicate samples were analyzed. Nevertheless, the difference in mtDNA4977 levels as detected in controls and cases was remarkable and statistically significant (P = .01).

Furthermore, both the amount of mtDNA (4.83-fold) and the nDNA per milligram of wet tissue ratio (16.36-fold) were reduced in glaucomatous TM (Table 1). This decrease of the nDNA per milligram of wet tissue ratio indicates the occurrence of a dramatic drop in cell number in the TM. This finding was paralleled by a rising incidence of mtDNA damage, as indicated by the increase in mtDNA deletion and the decrease in mtDNA copy number per cell.

A negative correlation between age and mtDNA:nDNA ratio was observed in controls (r = −0.192; P < .05) but not in patients with POAG (r = −0.069; P = .27).

TM VS IRIS COMPARISON IN PATIENTS WITH POAG

Mitochondrial loss and damage observed in patients with POAG selectively occurred only in the TM and not in the iris. In fact, mtDNA deletions were significantly higher in the TM than in the iris of the same patients, while mtDNA copy number and mtDNA:nDNA ratio were significantly decreased in the TM as compared with the iris. Finally, the nDNA per milligram of wet tissue ratio was lower in the TM than in the iris, a finding amenable to the different cellularity of these tissues (Table 2).

Table Grahic Jump LocationTable 2. mtDNA Damage as Evaluated in Parallel in the TM and Iris of the Same 19 Patients With POAG
FREQUENCIES OF GENETIC POLYMORPHISMS

The percentages of various polymorphisms as analyzed in patients with POAG and controls are reported in Table 3. None of these differences was statistically significant except an increased frequency of the GSTM1-null genotype in patients with POAG as compared with controls. By comparison, the frequency of the various genotypes as detected for each gene in the general population is reported (Table 3).

Table Grahic Jump LocationTable 3. Frequency of Analyzed Genetic Polymorphisms in Patients With Glaucoma, Controls, and the General Population as Inferred From Available Literature
INFLUENCES OF GENETIC POLYMORPHISMS ON MITOCHONDRIAL DAMAGE

OGG1 polymorphisms did not exert any significant influence on any of the molecular end points tested (Table 3). The GSTM1 homozygous deletion was associated with an increased level of mtDNA deletion (1.7-fold) and a decreased amount of total mtDNA (2.5-fold) and mtDNA:nDNA ratio (2.3-fold). Conversely, the amount of nDNA per milligram of wet tissue was not affected (Table 3). The FAS homozygous mutation was significantly correlated both with a decreased amount of mtDNA (2.3-fold) and mtDNA:nDNA ratio (3.2-fold). Conversely, no effect of this mutation was detected on the amounts of deleted mtDNA and nDNA per milligram of wet tissue (Table 3).

RELATIONSHIPS AMONG MOLECULAR END POINTS

The correlation between the mtDNA deletion and the mtDNA:nDNA ratio was not significant in controls (r = 0.090; P = .25) but was of borderline statistical significance in patients with glaucoma (r = −0.277; P = .06). These results indicate that mtDNA deletion is inversely related to the decrease of mtDNA copy number in patients with glaucoma but not in controls. No correlation was observed among the other molecular end points tested in controls or patients with glaucoma.

Though many studies in the literature analyze mitochondrial dysfunction in POAG, most of them were carried out on surrogate tissue (Table 4). To the best of our knowledge, our study is the largest study performed analyzing genetic polymorphisms and molecular alterations directly in TM.

Table Grahic Jump LocationTable 4. Mitochondrial Dysfunction in TM and Surrogate Tissues of Patients With Glaucomaa

Our study provides evidence that mtDNA damage occurs in the target tissue of POAG, the TM. Such damage is detectable only in the TM and not in other anterior chamber districts, eg, the iris. Genetic polymorphisms affect the amount of mtDNA damage in TM.

The level of mtDNA4977 detected in glaucomatous TM is remarkably high. By comparison, the level of mtDNA4977 as detected by our group using the herein-reported QPCR method in stemlike mammary cells spanned from 0.9% to 2.1% only.35 Markaryan et al15 detected a similar range of molecular lesions in different tissues of cochlear structures using the same method.

The high interindividual variation in the level of mtDNA4977, especially in patients with POAG, could be due to some still unidentified genetic polymorphisms or to the variability in the dietary intake of antioxidants. It is unlikely that such variability could be due to differences in diseases status because all patients were carriers of advanced unbalanced POAG requiring surgical trabeculectomy. Other variables possibly contributing to this variability might be related to mitochondrial haplotypes, which are characterized by different sensitivity to oxidative damage and undergo interindividual variations.36 However, to our knowledge, no direct relationship between mtDNA haplotypes and POAG prevalence has been reported.37

A further explanation for the high variability of mtDNA deletion observed in POAG may be due to the low amount of mtDNA detected that affects PCR amplification conditions requiring many amplification cycles.

Our findings shed light on mechanisms contributing to TM degeneration in POAG. In cases of oxidative stress, mitochondrial damage triggers apoptosis.38 39 These mechanisms result in degenerative phenomena in tissues composed of perennial cells, such as TM.

Our results are in agreement with previous studies performed in vitro in TM primary cultures collected from patients with POAG and donor eyes, indicating that in POAG mitochondrial dysfunction results in intracellular calcium and oxidative overload.30 Primary open-angle glaucoma–related mitochondrial alterations detected in vitro include lower adenosine triphosphate production and decreased transmembrane potential resulting in mitochondrial complex I defect associated with the degeneration of TM cells.11 The occurrence of mitochondrial functional defects in glaucomatous TM cells resulting in abnormal vulnerability to intracellular calcium increase has been reported.38

Mitochondrial haplogroups have been examined as a possible genetic factor for glaucoma. No association between mitochondrial haplogroups and POAG has been reported, although a possible association with primary angle-closure glaucoma has been reported in a small study.37 ,40

Mitochondrial damage and loss occurring in TM trigger both degenerative and apoptotic phenomena resulting in cell loss. This cell loss clinically manifests as IOP increase. Decrease of TM cellularity during glaucoma course has been previously reported, although to a lesser extent than those indicated by our results.41 Changes in TM composition during glaucoma course could contribute to the detected decrease of the DNA per millgram of wet tissue ratio.

The TM specificity of mtDNA damage in POAG is supported by the comparison with the iris of the same patients with POAG in whom such damage was not detected. This comparison was performed between 2 neighbor tissues of the anterior chamber, thus being highly specific. The lack of mtDNA damage in tissues different from TM is in agreement with the negative findings reported by other studies in blood lymphocytes of patients with POAG.42

A comparison of mitochondrial damage and genetic polymorphisms does not support a major role for OGG1 in POAG. Conversely, both GSTM1 and FAS appear to affect molecular damage occurring in TM of patients with POAG. Patients devoid of GSTM1 activity have increased mtDNA deletion. This finding may be interpreted as resulting from the decreased antioxidant defenses observed in subjects with GSTM1 deletion, demonstrated by the increased TM oxidative DNA damage in the GSTM1-null vs GSTM1-positive patients with POAG.19

FAS homozygous mutations did not exert an influence on the level of mtDNA deletion while decreasing the mtDNA copy number and the mtDNA:nDNA ratio. In the anterior chamber of the eye, FAS has been demonstrated to provoke apoptosis increasing myocilin release from mitochondria to cytosolic compartments of TM cells.31 Further studies are required to clarify in which glaucoma types, other than POAG, high levels of mtDNA deletion occur in TM.

In conclusion, our results indicate that patients with POAG bear genetic predisposition to oxidative stress contributing to mtDNA damage and apoptosis. Mitochondrial DNA deletion is a severe damage transmitted during mitochondrial mitosis to new mitochondrial progeny. Accordingly, mitochondrial damage progressively increases with age. On this basis, POAG may be interpreted as a mitochondriopathy affecting TM cells, thus hampering aqueous humor outflow.

Correspondence: Alberto Izzotti, MD, PhD, Department of Health Sciences, University of Genoa, Via Pastore 1, I-16132 Genoa, Italy (izzotti@unige.it).

Submitted for Publication: August 18, 2009; final revision received October 15, 2009; accepted November 25, 2009.

Author Contributions: Dr Izzotti had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.

Financial Disclosure: None reported.

Funding/Support: This study was supported by the Glaucoma Foundation.

Alvarado  JA, Yeh  RF, Franse-Carman  L, Marcellino  G, Brownstein  MJ. Interactions between endothelia of the trabecular meshwork and of Schlemm's canal: a new insight into the regulation of aqueous outflow in the eye. Trans Am Ophthalmol Soc 2005;103148- 162, discussion 162-163
PubMed
Alvarado  J, Murphy  CG, Juster  R. Trabecular meshwork cellularity in primary open-angle glaucoma and nonglaucomatous normals. Ophthalmology 1984;91 (6) 564- 579
PubMed
Saccà  SC, Pascotto  A, Camicione  P, Capris  P, Izzotti  A. Oxidative DNA damage in the human trabecular meshwork: clinical correlation in patients with primary open-angle glaucoma. Arch Ophthalmol 2005;123 (4) 458- 463
PubMed
Zhou  L, Li  Y, Yue  BY. Oxidative stress affects cytoskeletal structure and cell-matrix interactions in cells from an ocular tissue: the trabecular meshwork. J Cell Physiol 1999;180 (2) 182- 189
PubMed
Yu  AL, Fuchshofer  R, Kampik  A, Welge-Lüssen  U. Effects of oxidative stress in trabecular meshwork cells are reduced by prostaglandin analogues. Invest Ophthalmol Vis Sci 2008;49 (11) 4872- 4880
PubMed
Saccà  SC, Izzotti  A. Oxidative stress and glaucoma: injury in the anterior segment of the eye. Prog Brain Res 2008;173385- 407
PubMed
Sacca  SC, Bolognesi  C, Battistella  A, Bagnis  A, Izzotti  A. Gene-environment interactions in ocular diseases. Mutat Res 2009;667 (1-2) 98- 117
PubMed
Indo  HP, Davidson  M, Yen  HC.  et al.  Evidence of ROS generation by mitochondria in cells with impaired electron transport chain and mitochondrial DNA damage. Mitochondrion 2007;7 (1–2) 106- 118
PubMed
Prithivirajsingh  S, Story  MD, Bergh  SA.  et al.  Accumulation of the common mitochondrial DNA deletion induced by ionizing radiation. FEBS Lett 2004;571 (1–3) 227- 232
PubMed
Abu-Amero  KK, Morales  J, Bosley  TM. Mitochondrial abnormalities in patients with primary open-angle glaucoma. Invest Ophthalmol Vis Sci 2006;47 (6) 2533- 2541
PubMed
He  Y, Leung  KW, Zhang  YH.  et al.  Mitochondrial complex I defect induces ROS release and degeneration in trabecular meshwork cells of POAG patients: protection by antioxidants. Invest Ophthalmol Vis Sci 2008;49 (4) 1447- 1458
PubMed
Cortopassi  GA, Arnheim  N. Detection of a specific mitochondrial DNA deletion in tissues of older human. Nucleic Acids Res 1990;18 (23) 6927- 6933
PubMed
Izzotti  A, Saccà  SC, Longobardi  M, Cartiglia  C. Sensitivity of ocular anterior chamber tissues to oxidative damage and its relevance to the pathogenesis of glaucoma. Invest Ophthalmol Vis Sci 2009;50 (11) 5251- 5258
PubMed
Pogozelski  WK, Hamel  CJ, Woeller  CF.  et al.  Quantification of total mitochondrial DNA and the 4977-bp common deletion in Pearson's syndrome lymphoblasts using a fluorogenic 5′-nuclease (TaqMan) real-time polymerase chain reaction assay and plasmid external calibration standards. Mitochondrion 2003;2 (6) 415- 427
PubMed
Markaryan  A, Nelson  EG, Tretiakova  M, Hinojosa  R. Technical report: laser microdissection of cochlear structures from celloidin embedded human temporal bone tissues and detection of the mitochondrial DNA common deletion using real time PCR. Hear Res 2008;244 (1-2) 1- 6
PubMed
Votruba  M. Molecular genetic basis of primary inherited optic neuropathies. Eye (Lond) 2004;18 (11) 1126- 1132
PubMed
Ueda  J, Wentz-Hunter  KK, Cheng  EL, Fukuchi  T, Abe  H, Yue  BY. Ultrastructural localization of myocilin in human trabecular meshwork cells and tissues. J Histochem Cytochem 2000;48 (10) 1321- 1330
PubMed
Izzotti  A, Saccà  SC. Glutathione S-transferase M1 and its implications in glaucoma pathogenesis: a controversial matter. Exp Eye Res 2004;79 (1) 141- 142, author reply 143
PubMed
Izzotti  A, Saccà  SC, Cartiglia  C, De Flora  S. Oxidative deoxyribonucleic acid damage in the eyes of glaucoma patients. Am J Med 2003;114 (8) 638- 646
PubMed
Sun  T, Miao  X, Zhang  X, Tan  W, Xiong  P, Lin  D. Polymorphisms of death pathway genes FAS and FASL in esophageal squamous-cell carcinoma. J Natl Cancer Inst 2004;96 (13) 1030- 1036
PubMed
Yildirim  O, Ateş  NA, Tamer  L.  et al.  May glutathione S-transferase M1 positive genotype afford protection against primary open-angle glaucoma? Graefes Arch Clin Exp Ophthalmol 2005;243 (4) 327- 333
PubMed
Jansson  M, Rada  A, Tomic  L, Larsson  LI, Wadelius  C. Analysis of the glutathione S-transferase M1 gene using pyrosequencing and multiplex PCR-no evidence of association to glaucoma. Exp Eye Res 2003;77 (2) 239- 243
PubMed
Oka  S, Ohno  M, Tsuchimoto  D, Sakumi  K, Furuichi  M, Nakabeppu  Y. Two distinct pathways of cell death triggered by oxidative damage to nuclear and mitochondrial DNAs. EMBO J 2008;27 (2) 421- 432
PubMed
Hamblet  NS, Castora  FJ. Mitochondrial DNA deletion analysis. a comparison of PCR quantitative methods. Biochem Biophys Res Commun 1995;207 (2) 839- 847
PubMed
Izzotti  A, De Flora  S, Cartiglia  C.  et al.  Interplay between Helicobacter pylori and host gene polymorphisms in inducing oxidative DNA damage in the gastric mucosa. Carcinogenesis 2007;28 (4) 892- 898
PubMed
He  Y, Leung  KW, Zhuo  YH, Ge  J. Pro370Leu mutant myocilin impairs mitochondrial functions in human trabecular meshwork cells. Mol Vis 2009;15815- 825
PubMed
Wang  L, Zhuo  Y, Liu  B, Huang  S, Hou  F, Ge  J. Pro370Leu mutant myocilin disturbs the endoplasm reticulum stress response and mitochondrial membrane potential in human trabecular meshwork cells. Mol Vis 2007;13618- 625
PubMed
Sohn  S, Hur  W, Joe  MK.  et al.  Expression of wild-type and truncated myocilins in trabecular meshwork cells: their subcellular localizations and cytotoxicities. Invest Ophthalmol Vis Sci 2002;43 (12) 3680- 3685
PubMed
Kong  XM, Sun  XH, Yu  DY, Guo  WY, Yu  XB. Study of retinal microvessels in a Rhesus monkey model of chronic high intraocular pressure. Vet Ophthalmol 2008;11 (5) 321- 326
PubMed
He  Y, Ge  J, Tombran-Tink  J. Mitochondrial defects and dysfunction in calcium regulation in glaucomatous trabecular meshwork cells. Invest Ophthalmol Vis Sci 2008;49 (11) 4912- 4922
PubMed
Sakai  H, Shen  X, Koga  T.  et al.  Mitochondrial association of myocillin, product of a glaucoma gene, in human trabecular meshwork cells. J Cell Physiol 2007;213 (3) 775- 784
PubMed
Li  G, Luna  C, Liton  PB, Navarro  I, Epstein  DL, Gonzalez  P. Sustained stress response after oxidative stress in trabecular meshwork cells. Mol Vis 2007;132282- 2288
PubMed
Bagiyeva  S, Marfany  G, Gonzalez-Angulo  O, Gonzalez-Duarte  R. Mutational screening of CYP1B1 in Turkish PCG families and functional analyses of newly detected mutations. Mol Vis 2007;131458- 1468
PubMed
Wentz-Hunter  K, Shen  X, Yue  BY. Distribution of myocilin, a glaucoma gene product, in human corneal fibroblasts. Mol Vis 2003;9308- 314
PubMed
De Flora  S, Scarfì  S, Izzotti  A.  et al.  Induction by 7,12-dimethylbenz(a)anthracene of molecular and biochemical alterations in transformed human mammary epithelial stem cells, and protection by N-acetylcysteine. Int J Oncol 2006;29 (3) 521- 529
PubMed
Kofler  B, Mueller  E, Eder  W.  et al.  Mitochondrial DNA haplogroup T is associated with coronary artery disease and diabetic retinopathy: a case control study. BMC Med Genet 2009;1035
PubMed
Andrews  R, Ressiniotis  T, Turnbull  DM.  et al.  The role of mitochondrial haplogroups in primary open angle glaucoma. Br J Ophthalmol 2006;90 (4) 488- 490
PubMed
Takahashi  A, Masuda  A, Sun  M, Centonze  VE, Herman  B. Oxidative stress-induced apoptosis is associated with alterations in mitochondrial caspase activity and Bcl-2-dependent alterations in mitochondrial pH (pHm). Brain Res Bull 2004;62 (6) 497- 504
PubMed
Bossy-Wetzel  E, Barsoum  MJ, Godzik  A, Schwarzenbacher  R, Lipton  SA. Mitochondrial fission in apoptosis, neurodegeneration and aging. Curr Opin Cell Biol 2003;15 (6) 706- 716
PubMed
Abu-Amero  KK, Morales  J, Bosley  TM, Mohamed  GH, Cabrera  VM. The role of mitochondrial haplogroups in glaucoma: a study in an Arab population. Mol Vis 2008;14518- 522
PubMed
Hamard  P, Valtot  F, Sourdille  P, Bourles-Dagonet  F, Baudouin  C. Confocal microscopic examination of trabecular meshwork removed during ab externo trabeculectomy. Br J Ophthalmol 2002;86 (9) 1046- 1052
PubMed
Abu-Amero  KK, Morales  J, Osman  MN, Bosley  TM. Nuclear and mitochondrial analysis of patients with primary angle-closure glaucoma. Invest Ophthalmol Vis Sci 2007;48 (12) 5591- 5596
PubMed

First Page Preview

First page PDF preview

Figures

Figure 1.

Evaluation of the 4977–base pair mitochondrial DNA (mtDNA4977) deletion and mtDNA copy number by real-time quantitative polymerase chain reaction in the trabecular meshwork. Molecular beacon probes emit fluorescent light only when the deletion of mtDNA is present.

Grahic Jump Location
Figure 2.

Electropherogram of the amplification products. A, The peak at elution time 95 seconds corresponds to the 474–base pair (bp) tract of mitochondrial DNA (mtDNA) not susceptible to deletion. B, The peak at elution time 90 seconds corresponds to the 400-bp amplicon flanking the deletion site. The blue line corresponds to a control sample and the red line, to a primary open-angle glaucoma (POAG) sample. Part A shows that the amount of mtDNA in both samples was the same (the curves overlap perfectly). Part B shows that the deletion amount is higher in the POAG sample than in the control sample (red peak higher than the blue one).

Grahic Jump Location

Tables

Table Grahic Jump LocationTable 1. mtDNA Damage in TM as Detected in 79 Patients With POAG and 156 Controls
Table Grahic Jump LocationTable 2. mtDNA Damage as Evaluated in Parallel in the TM and Iris of the Same 19 Patients With POAG
Table Grahic Jump LocationTable 3. Frequency of Analyzed Genetic Polymorphisms in Patients With Glaucoma, Controls, and the General Population as Inferred From Available Literature
Table Grahic Jump LocationTable 4. Mitochondrial Dysfunction in TM and Surrogate Tissues of Patients With Glaucomaa

Interactive Graphics

Video

Country-Specific Mortality and Growth Failure in Infancy and Yound Children and Association With Material Stature

Use interactive graphics and maps to view and sort country-specific infant and early dhildhood mortality and growth failure data and their association with maternal

Alvarado  JA, Yeh  RF, Franse-Carman  L, Marcellino  G, Brownstein  MJ. Interactions between endothelia of the trabecular meshwork and of Schlemm's canal: a new insight into the regulation of aqueous outflow in the eye. Trans Am Ophthalmol Soc 2005;103148- 162, discussion 162-163
PubMed
Alvarado  J, Murphy  CG, Juster  R. Trabecular meshwork cellularity in primary open-angle glaucoma and nonglaucomatous normals. Ophthalmology 1984;91 (6) 564- 579
PubMed
Saccà  SC, Pascotto  A, Camicione  P, Capris  P, Izzotti  A. Oxidative DNA damage in the human trabecular meshwork: clinical correlation in patients with primary open-angle glaucoma. Arch Ophthalmol 2005;123 (4) 458- 463
PubMed
Zhou  L, Li  Y, Yue  BY. Oxidative stress affects cytoskeletal structure and cell-matrix interactions in cells from an ocular tissue: the trabecular meshwork. J Cell Physiol 1999;180 (2) 182- 189
PubMed
Yu  AL, Fuchshofer  R, Kampik  A, Welge-Lüssen  U. Effects of oxidative stress in trabecular meshwork cells are reduced by prostaglandin analogues. Invest Ophthalmol Vis Sci 2008;49 (11) 4872- 4880
PubMed
Saccà  SC, Izzotti  A. Oxidative stress and glaucoma: injury in the anterior segment of the eye. Prog Brain Res 2008;173385- 407
PubMed
Sacca  SC, Bolognesi  C, Battistella  A, Bagnis  A, Izzotti  A. Gene-environment interactions in ocular diseases. Mutat Res 2009;667 (1-2) 98- 117
PubMed
Indo  HP, Davidson  M, Yen  HC.  et al.  Evidence of ROS generation by mitochondria in cells with impaired electron transport chain and mitochondrial DNA damage. Mitochondrion 2007;7 (1–2) 106- 118
PubMed
Prithivirajsingh  S, Story  MD, Bergh  SA.  et al.  Accumulation of the common mitochondrial DNA deletion induced by ionizing radiation. FEBS Lett 2004;571 (1–3) 227- 232
PubMed
Abu-Amero  KK, Morales  J, Bosley  TM. Mitochondrial abnormalities in patients with primary open-angle glaucoma. Invest Ophthalmol Vis Sci 2006;47 (6) 2533- 2541
PubMed
He  Y, Leung  KW, Zhang  YH.  et al.  Mitochondrial complex I defect induces ROS release and degeneration in trabecular meshwork cells of POAG patients: protection by antioxidants. Invest Ophthalmol Vis Sci 2008;49 (4) 1447- 1458
PubMed
Cortopassi  GA, Arnheim  N. Detection of a specific mitochondrial DNA deletion in tissues of older human. Nucleic Acids Res 1990;18 (23) 6927- 6933
PubMed
Izzotti  A, Saccà  SC, Longobardi  M, Cartiglia  C. Sensitivity of ocular anterior chamber tissues to oxidative damage and its relevance to the pathogenesis of glaucoma. Invest Ophthalmol Vis Sci 2009;50 (11) 5251- 5258
PubMed
Pogozelski  WK, Hamel  CJ, Woeller  CF.  et al.  Quantification of total mitochondrial DNA and the 4977-bp common deletion in Pearson's syndrome lymphoblasts using a fluorogenic 5′-nuclease (TaqMan) real-time polymerase chain reaction assay and plasmid external calibration standards. Mitochondrion 2003;2 (6) 415- 427
PubMed
Markaryan  A, Nelson  EG, Tretiakova  M, Hinojosa  R. Technical report: laser microdissection of cochlear structures from celloidin embedded human temporal bone tissues and detection of the mitochondrial DNA common deletion using real time PCR. Hear Res 2008;244 (1-2) 1- 6
PubMed
Votruba  M. Molecular genetic basis of primary inherited optic neuropathies. Eye (Lond) 2004;18 (11) 1126- 1132
PubMed
Ueda  J, Wentz-Hunter  KK, Cheng  EL, Fukuchi  T, Abe  H, Yue  BY. Ultrastructural localization of myocilin in human trabecular meshwork cells and tissues. J Histochem Cytochem 2000;48 (10) 1321- 1330
PubMed
Izzotti  A, Saccà  SC. Glutathione S-transferase M1 and its implications in glaucoma pathogenesis: a controversial matter. Exp Eye Res 2004;79 (1) 141- 142, author reply 143
PubMed
Izzotti  A, Saccà  SC, Cartiglia  C, De Flora  S. Oxidative deoxyribonucleic acid damage in the eyes of glaucoma patients. Am J Med 2003;114 (8) 638- 646
PubMed
Sun  T, Miao  X, Zhang  X, Tan  W, Xiong  P, Lin  D. Polymorphisms of death pathway genes FAS and FASL in esophageal squamous-cell carcinoma. J Natl Cancer Inst 2004;96 (13) 1030- 1036
PubMed
Yildirim  O, Ateş  NA, Tamer  L.  et al.  May glutathione S-transferase M1 positive genotype afford protection against primary open-angle glaucoma? Graefes Arch Clin Exp Ophthalmol 2005;243 (4) 327- 333
PubMed
Jansson  M, Rada  A, Tomic  L, Larsson  LI, Wadelius  C. Analysis of the glutathione S-transferase M1 gene using pyrosequencing and multiplex PCR-no evidence of association to glaucoma. Exp Eye Res 2003;77 (2) 239- 243
PubMed
Oka  S, Ohno  M, Tsuchimoto  D, Sakumi  K, Furuichi  M, Nakabeppu  Y. Two distinct pathways of cell death triggered by oxidative damage to nuclear and mitochondrial DNAs. EMBO J 2008;27 (2) 421- 432
PubMed
Hamblet  NS, Castora  FJ. Mitochondrial DNA deletion analysis. a comparison of PCR quantitative methods. Biochem Biophys Res Commun 1995;207 (2) 839- 847
PubMed
Izzotti  A, De Flora  S, Cartiglia  C.  et al.  Interplay between Helicobacter pylori and host gene polymorphisms in inducing oxidative DNA damage in the gastric mucosa. Carcinogenesis 2007;28 (4) 892- 898
PubMed
He  Y, Leung  KW, Zhuo  YH, Ge  J. Pro370Leu mutant myocilin impairs mitochondrial functions in human trabecular meshwork cells. Mol Vis 2009;15815- 825
PubMed
Wang  L, Zhuo  Y, Liu  B, Huang  S, Hou  F, Ge  J. Pro370Leu mutant myocilin disturbs the endoplasm reticulum stress response and mitochondrial membrane potential in human trabecular meshwork cells. Mol Vis 2007;13618- 625
PubMed
Sohn  S, Hur  W, Joe  MK.  et al.  Expression of wild-type and truncated myocilins in trabecular meshwork cells: their subcellular localizations and cytotoxicities. Invest Ophthalmol Vis Sci 2002;43 (12) 3680- 3685
PubMed
Kong  XM, Sun  XH, Yu  DY, Guo  WY, Yu  XB. Study of retinal microvessels in a Rhesus monkey model of chronic high intraocular pressure. Vet Ophthalmol 2008;11 (5) 321- 326
PubMed
He  Y, Ge  J, Tombran-Tink  J. Mitochondrial defects and dysfunction in calcium regulation in glaucomatous trabecular meshwork cells. Invest Ophthalmol Vis Sci 2008;49 (11) 4912- 4922
PubMed
Sakai  H, Shen  X, Koga  T.  et al.  Mitochondrial association of myocillin, product of a glaucoma gene, in human trabecular meshwork cells. J Cell Physiol 2007;213 (3) 775- 784
PubMed
Li  G, Luna  C, Liton  PB, Navarro  I, Epstein  DL, Gonzalez  P. Sustained stress response after oxidative stress in trabecular meshwork cells. Mol Vis 2007;132282- 2288
PubMed
Bagiyeva  S, Marfany  G, Gonzalez-Angulo  O, Gonzalez-Duarte  R. Mutational screening of CYP1B1 in Turkish PCG families and functional analyses of newly detected mutations. Mol Vis 2007;131458- 1468
PubMed
Wentz-Hunter  K, Shen  X, Yue  BY. Distribution of myocilin, a glaucoma gene product, in human corneal fibroblasts. Mol Vis 2003;9308- 314
PubMed
De Flora  S, Scarfì  S, Izzotti  A.  et al.  Induction by 7,12-dimethylbenz(a)anthracene of molecular and biochemical alterations in transformed human mammary epithelial stem cells, and protection by N-acetylcysteine. Int J Oncol 2006;29 (3) 521- 529
PubMed
Kofler  B, Mueller  E, Eder  W.  et al.  Mitochondrial DNA haplogroup T is associated with coronary artery disease and diabetic retinopathy: a case control study. BMC Med Genet 2009;1035
PubMed
Andrews  R, Ressiniotis  T, Turnbull  DM.  et al.  The role of mitochondrial haplogroups in primary open angle glaucoma. Br J Ophthalmol 2006;90 (4) 488- 490
PubMed
Takahashi  A, Masuda  A, Sun  M, Centonze  VE, Herman  B. Oxidative stress-induced apoptosis is associated with alterations in mitochondrial caspase activity and Bcl-2-dependent alterations in mitochondrial pH (pHm). Brain Res Bull 2004;62 (6) 497- 504
PubMed
Bossy-Wetzel  E, Barsoum  MJ, Godzik  A, Schwarzenbacher  R, Lipton  SA. Mitochondrial fission in apoptosis, neurodegeneration and aging. Curr Opin Cell Biol 2003;15 (6) 706- 716
PubMed
Abu-Amero  KK, Morales  J, Bosley  TM, Mohamed  GH, Cabrera  VM. The role of mitochondrial haplogroups in glaucoma: a study in an Arab population. Mol Vis 2008;14518- 522
PubMed
Hamard  P, Valtot  F, Sourdille  P, Bourles-Dagonet  F, Baudouin  C. Confocal microscopic examination of trabecular meshwork removed during ab externo trabeculectomy. Br J Ophthalmol 2002;86 (9) 1046- 1052
PubMed
Abu-Amero  KK, Morales  J, Osman  MN, Bosley  TM. Nuclear and mitochondrial analysis of patients with primary angle-closure glaucoma. Invest Ophthalmol Vis Sci 2007;48 (12) 5591- 5596
PubMed

Correspondence

CME Course for:


You need to register in order to view this quiz.


To understand the clinical management of acute heart failure syndromes.
Accreditation Information The American Medical Association is accredited by the Accreditation Council for Continuing Medical Education to provide continuing medical education for physicians.
The AMA designates this journal-based CME activity for a maximum of 1 AMA PRA Category 1 CreditTM per course. Physicians should claim only the credit commensurate with the extent of their participation in the activity.
Physicians who complete the CME course and score at least 80% correct on the quiz are eligible for AMA PRA Category 1 CreditTM.
Note: You must get at least of the answers correct to pass this quiz.
Note: You must get at least of the answers correct to pass this quiz.
You have not filled in all the answers to complete this quiz
The following questions were not answered:
Sorry, you have unsuccessfully completed this CME quiz with a score of
The following questions were not answered correctly:
For CME Course: A Proposed Model for Initial Assessment and Management of Acute Heart Failure Syndromes
Indicate what changes(s) you will implement in your practice, if any, based on this CME course.
To view and print your certificate and access a summary of your CME courses go to My CME.
NOTE:
Citing articles are presented as examples only. In non-demo SCM6 implementation, integration with CrossRef’s “Cited By” API will populate this tab (http://www.crossref.org/citedby.html).
Submit a Comment

Some tools below are only available to our subscribers or users with an online account.

Related Content

Customize your page view by dragging & repositioning the boxes below.

Articles Related By Topic
Related Topics
PubMed Articles